Construct: ORF TRCN0000468066
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012319.1_s317c1
- Derived from:
- ccsbBroadEn_08679
- DNA Barcode:
- TAAAAGACAGTAGATAGGGTGATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- POGLUT1 (56983)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468066
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | NM_152305.3 | 99.7% | 99.4% | 224A>G;327T>C;685C>A |
| 2 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XM_006713705.3 | 59.3% | 59.1% | 0_1ins477;208C>A |
| 3 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XM_017006878.2 | 59.3% | 59.1% | 0_1ins477;208C>A |
| 4 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XM_017006879.1 | 59.3% | 59.1% | 0_1ins477;208C>A |
| 5 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XM_024453643.1 | 59.3% | 59.1% | 0_1ins477;208C>A |
| 6 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XR_001740211.2 | 32.4% | (many diffs) | |
| 7 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | NR_024265.2 | 32.1% | (many diffs) | |
| 8 | human | 56983 | POGLUT1 | protein O-glucosyltransfera... | XR_001740212.2 | 32.1% | (many diffs) | |
| 9 | mouse | 224143 | Poglut1 | protein O-glucosyltransfera... | NM_172380.4 | 87.5% | 90.8% | (many diffs) |
| 10 | mouse | 224143 | Poglut1 | protein O-glucosyltransfera... | NM_001300827.1 | 71.1% | 75.2% | (many diffs) |
| 11 | mouse | 224143 | Poglut1 | protein O-glucosyltransfera... | XR_875792.2 | 35.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gtggtgggct agctcgccgc ttcggctctg gctgctgttg ttcctcctgc 121 cctcagcgca gggccgccag aaggagtcag gttcaaaatg gaaagtattt attgaccaaa 181 ttaacaggtc tttggagaat tacgaaccat gttcaagtca aaactgcagc tgctaccatg 241 gtgtcataga agaggatcta actcctttcc gaggaggcat ctccaggagg atgatggcag 301 aggtagtcag acggaagcta gggacccact atcagatcac taagaacaga ctgtaccggg 361 aaaatgactg catgttcccc tcaaggtgta gcggtgttga gcactttatt ttggaagtga 421 tcgggcgtct ccctgacatg gagatggtga tcaatgtacg agattatcct caggttccta 481 aatggatgga gcctgccatc ccagtcttct ccttcagtaa gacatcagag taccatgata 541 tcatgtatcc tgcttggaca ttttgggaag ggggacctgc tgtttggcca atttatccta 601 caggtcttgg acggtgggac ctcttcagag aagatctggt aaggtcagca gcacagtggc 661 catggaaaaa gaaaaactct acagcatatt tccgaggatc aaggacaagt ccagaacgag 721 atcctctcat tcttctgtct cggaaaaaca caaaacttgt tgatgcagaa tacaccaaaa 781 accaggcctg gaaatctatg aaagataccT TAGGAAAGCC AGCTGCTAAG GATGTCCATC 841 TTGTGGATCA CTGCAAATAC AAGTATCTGT TTAATTTTCG AGGCGTAGCT GCAAGTTTCC 901 GGTTTAAACA CCTCTTCCTG TGTGGCTCAC TTGTTTTCCA TGTTGGTGAT GAGTGGCTAG 961 AATTCTTCTA TCCACAGCTG AAGCCATGGG TTCACTATAT CCCAGTCAAA ACAGATCTCT 1021 CCAATGTCCA AGAGCTGTTA CAATTTGTAA AAGCAAATGA TGATGTAGCT CAAGAGATTG 1081 CTGAAAGGGG AAGCCAGTTT ATTAGGAACC ATTTGCAGAT GGATGACATC ACCTGTTACT 1141 GGGAGAACCT CTTGAGTGAA TACTCTAAAT TCCTGTCTTA TAATGTAACG AGAAGGAAAG 1201 GTTATGATCA AATTATTCCC AAAATGTTGA AAACTGAACT ATACCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGATAA AAGACAGTAG ATAGGGTGAT CACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t