Transcript: Mouse NM_001300827.1

Mus musculus protein O-glucosyltransferase 1 (Poglut1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Poglut1 (224143)
Length:
3038
CDS:
518..1471

Additional Resources:

NCBI RefSeq record:
NM_001300827.1
NBCI Gene record:
Poglut1 (224143)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001300827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093331 CCTCATAGATCACTGCAAATA pLKO.1 1066 CDS 100% 13.200 18.480 N Poglut1 n/a
2 TRCN0000093329 CGGGTCATCTACGTGTGTTAT pLKO.1 1741 3UTR 100% 13.200 10.560 N Poglut1 n/a
3 TRCN0000093333 GATCATTAAGAACCGGTTATT pLKO.1 562 CDS 100% 13.200 9.240 N Poglut1 n/a
4 TRCN0000093330 CCAGTTCATCATAAACCATTT pLKO.1 1321 CDS 100% 10.800 7.560 N Poglut1 n/a
5 TRCN0000093332 CCCTGACATGGAAATGGTAAT pLKO.1 658 CDS 100% 10.800 7.560 N Poglut1 n/a
6 TRCN0000154690 GAGATTATCCTCAGGTTCCTA pLKO.1 687 CDS 100% 3.000 2.100 N POGLUT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001300827.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15932 pDONR223 0% 71.3% 75.5% None (many diffs) n/a
2 ccsbBroad304_15932 pLX_304 0% 71.3% 75.5% V5 (many diffs) n/a
3 TRCN0000467409 TACAATGTACCATGTCAAGCCAAT pLX_317 28.4% 71.3% 75.5% V5 (many diffs) n/a
4 ccsbBroadEn_08679 pDONR223 100% 71.1% 75.2% None (many diffs) n/a
5 ccsbBroad304_08679 pLX_304 0% 71.1% 75.2% V5 (many diffs) n/a
6 TRCN0000468066 TAAAAGACAGTAGATAGGGTGATC pLX_317 37% 71.1% 75.2% V5 (many diffs) n/a
Download CSV