Transcript: Human XM_024453643.1

PREDICTED: Homo sapiens protein O-glucosyltransferase 1 (POGLUT1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POGLUT1 (56983)
Length:
4714
CDS:
1743..2444

Additional Resources:

NCBI RefSeq record:
XM_024453643.1
NBCI Gene record:
POGLUT1 (56983)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000151420 GTCCAAGAGCTGTTACAATTT pLKO.1 2226 CDS 100% 13.200 18.480 N POGLUT1 n/a
2 TRCN0000372878 GGTGATCAATGTACGAGATTA pLKO_005 448 5UTR 100% 13.200 10.560 N POGLUT1 n/a
3 TRCN0000156242 CCACATAGAAAGAGGCCAATT pLKO.1 3052 3UTR 100% 10.800 8.640 N POGLUT1 n/a
4 TRCN0000378894 CCATAAGCTTGGCACCTATAC pLKO_005 2512 3UTR 100% 10.800 8.640 N POGLUT1 n/a
5 TRCN0000155317 GCTGCAAGTTTCCGGTTTAAA pLKO.1 2088 CDS 100% 15.000 10.500 N POGLUT1 n/a
6 TRCN0000421421 GAACTATAGTAGTCATCATAG pLKO_005 2436 CDS 100% 10.800 7.560 N POGLUT1 n/a
7 TRCN0000158292 CCAGAACGAGATCCTCTCATT pLKO.1 1911 CDS 100% 4.950 3.465 N POGLUT1 n/a
8 TRCN0000156753 GCTGCTAAGGATGTCCATCTT pLKO.1 2022 CDS 100% 4.950 3.465 N POGLUT1 n/a
9 TRCN0000154690 GAGATTATCCTCAGGTTCCTA pLKO.1 462 5UTR 100% 3.000 2.100 N POGLUT1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453643.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15932 pDONR223 0% 59.4% 59.4% None 0_1ins477 n/a
2 ccsbBroad304_15932 pLX_304 0% 59.4% 59.4% V5 0_1ins477 n/a
3 TRCN0000467409 TACAATGTACCATGTCAAGCCAAT pLX_317 28.4% 59.4% 59.4% V5 0_1ins477 n/a
4 ccsbBroadEn_08679 pDONR223 100% 59.3% 59.1% None 0_1ins477;208C>A n/a
5 ccsbBroad304_08679 pLX_304 0% 59.3% 59.1% V5 0_1ins477;208C>A n/a
6 TRCN0000468066 TAAAAGACAGTAGATAGGGTGATC pLX_317 37% 59.3% 59.1% V5 0_1ins477;208C>A n/a
Download CSV