Construct: ORF TRCN0000468072
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004728.1_s317c1
- Derived from:
- ccsbBroadEn_03495
- DNA Barcode:
- TCTTCGTGCCCTGGTTTTGTCCTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TRNAU1AP (54952)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468072
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54952 | TRNAU1AP | tRNA selenocysteine 1 assoc... | NM_017846.5 | 100% | 100% | |
| 2 | human | 54952 | TRNAU1AP | tRNA selenocysteine 1 assoc... | NR_003109.1 | 42.3% | 1_94del;320_467del;1104_2032del | |
| 3 | mouse | 71787 | Trnau1ap | tRNA selenocysteine 1 assoc... | NM_027925.3 | 92.5% | 98.9% | (many diffs) |
| 4 | mouse | 71787 | Trnau1ap | tRNA selenocysteine 1 assoc... | XM_006539180.3 | 70% | 75.9% | (many diffs) |
| 5 | mouse | 71787 | Trnau1ap | tRNA selenocysteine 1 assoc... | XM_011250332.2 | 56.5% | 60.6% | (many diffs) |
| 6 | mouse | 71787 | Trnau1ap | tRNA selenocysteine 1 assoc... | XM_011250334.1 | 56.5% | 60.6% | (many diffs) |
| 7 | mouse | 71787 | Trnau1ap | tRNA selenocysteine 1 assoc... | XM_017320388.1 | 56.5% | 60.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 927
- ORF length:
- 861
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggccagcctg tggatgggcg acctggaacc ctacatggat gagaacttca 121 tctccagagc ctttgccacc atgggggaga ccgtaatgag cgtcaaaatt atccgaaacc 181 gcctcactgg gatcccagct ggctactgct ttgtagaatt tgcagatttg gccacagctg 241 agaagtgttt gcataaaatt aatgggaaac cccttccagg agccacacct gcgaaacgtt 301 ttaaactgaa ctatgccact tacgggaaac aaccagataa cagccctgag tattccctct 361 ttgtggggga cctgaccccg gacgtggatg atggcatgct gtatgaattc ttcgtcaaag 421 tctacccctc ctgtcgggga ggcaaggtgg ttttggacca gacaggcgtg tctaagggtt 481 atggttttgt gaaattcaca gatgaactgg aacagaagcg agccctgacg gagtgccagg 541 gagcagtggg actggggtct aagcctgtgc ggcTGAGCGT GGCAATCCCT AAAGCGAGCC 601 GTGTAAAGCC AGTGGAATAT AGTCAGATGT ACAGTTATAG CTACAACCAG TATTATCAGC 661 AGTACCAGAA CTACTATGCT CAGTGGGGCT ATGACCAGAA CACAGGCAGC TACAGCTACA 721 GTTACCCCCA GTATGGCTAT ACCCAGAGCA CCATGCAGAC ATATGAAGAA GTTGGAGATG 781 ATGCATTGGA AGACCCCATG CCACAGCTGG ATGTGACTGA GGCCAACAAG GAGTTCATGG 841 AACAGAGTGA GGAGCTGTAT GACGCTCTGA TGGACTGTCA CTGGCAGCCC CTGGACACAG 901 TGTCTTCAGA GATCCCTGCC ATGATGTACC CAACTTTCTT GTACAAAGTG GTTGATATCG 961 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 1021 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GATCTTCGTG 1081 CCCTGGTTTT GTCCTCACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 1141 aagatt