Transcript: Human NM_017846.5

Homo sapiens tRNA selenocysteine 1 associated protein 1 (TRNAU1AP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
TRNAU1AP (54952)
Length:
1799
CDS:
27..890

Additional Resources:

NCBI RefSeq record:
NM_017846.5
NBCI Gene record:
TRNAU1AP (54952)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_017846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236580 TTACGGGAAACAACCAGATAA pLKO_005 281 CDS 100% 13.200 18.480 N TRNAU1AP n/a
2 TRCN0000236577 TTATAGCTACAACCAGTATTA pLKO_005 596 CDS 100% 13.200 18.480 N TRNAU1AP n/a
3 TRCN0000236579 CAGGCGTGTCTAAGGGTTATG pLKO_005 424 CDS 100% 10.800 15.120 N TRNAU1AP n/a
4 TRCN0000159337 GCCATATTTGAGTCCTAACTT pLKO.1 1274 3UTR 100% 5.625 7.875 N TRNAU1AP n/a
5 TRCN0000236578 CCCTAAAGCGAGCCGTGTAAA pLKO_005 548 CDS 100% 13.200 9.240 N TRNAU1AP n/a
6 TRCN0000236581 TTGTAGGACCTGCCATATTTG pLKO_005 1263 3UTR 100% 13.200 9.240 N TRNAU1AP n/a
7 TRCN0000159819 GCTGCATTCATTTGACCATTT pLKO.1 1034 3UTR 100% 10.800 7.560 N TRNAU1AP n/a
8 TRCN0000162184 CCTACATGGATGAGAACTTCA pLKO.1 61 CDS 100% 4.950 3.465 N TRNAU1AP n/a
9 TRCN0000162647 CTTACGGGAAACAACCAGATA pLKO.1 280 CDS 100% 4.950 3.465 N TRNAU1AP n/a
10 TRCN0000160495 CAACCAGTATTATCAGCAGTA pLKO.1 605 CDS 100% 4.050 2.835 N TRNAU1AP n/a
11 TRCN0000165060 GCCAACAAGGAGTTCATGGAA pLKO.1 783 CDS 100% 3.000 2.100 N TRNAU1AP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_017846.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03495 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03495 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468072 TCTTCGTGCCCTGGTTTTGTCCTC pLX_317 41.3% 100% 100% V5 n/a
4 ccsbBroadEn_12119 pDONR223 100% 61.6% 61.6% None 1_330del n/a
5 ccsbBroad304_12119 pLX_304 0% 61.6% 61.6% V5 1_330del n/a
Download CSV