Transcript: Mouse NM_027925.3

Mus musculus tRNA selenocysteine 1 associated protein 1 (Trnau1ap), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Trnau1ap (71787)
Length:
1146
CDS:
160..1023

Additional Resources:

NCBI RefSeq record:
NM_027925.3
NBCI Gene record:
Trnau1ap (71787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_027925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103862 CGTGTCTAAGGGCTATGGTTT pLKO.1 561 CDS 100% 4.950 6.930 N Trnau1ap n/a
2 TRCN0000103863 AGCCGAGAAGTGTTTGCATAA pLKO.1 330 CDS 100% 10.800 8.640 N Trnau1ap n/a
3 TRCN0000103864 GATGTGACTGAAGCCAACAAA pLKO.1 904 CDS 100% 5.625 3.938 N Trnau1ap n/a
4 TRCN0000162184 CCTACATGGATGAGAACTTCA pLKO.1 194 CDS 100% 4.950 3.465 N TRNAU1AP n/a
5 TRCN0000103861 CTGTATGAGTTCTTTGTCAAA pLKO.1 493 CDS 100% 4.950 3.465 N Trnau1ap n/a
6 TRCN0000103860 GAGGCCTAGAATAATGACCTT pLKO.1 1040 3UTR 100% 2.640 1.848 N Trnau1ap n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_027925.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03495 pDONR223 100% 92.5% 98.9% None (many diffs) n/a
2 ccsbBroad304_03495 pLX_304 0% 92.5% 98.9% V5 (many diffs) n/a
3 TRCN0000468072 TCTTCGTGCCCTGGTTTTGTCCTC pLX_317 41.3% 92.5% 98.9% V5 (many diffs) n/a
4 ccsbBroadEn_12119 pDONR223 100% 56.5% 60.6% None (many diffs) n/a
5 ccsbBroad304_12119 pLX_304 0% 56.5% 60.6% V5 (many diffs) n/a
Download CSV