Construct: ORF TRCN0000468146
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010517.1_s317c1
- Derived from:
- ccsbBroadEn_05463
- DNA Barcode:
- AATGCAGGGCAGGAAACACACTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SPOPL (339745)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468146
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 339745 | SPOPL | speckle type BTB/POZ protei... | NM_001001664.3 | 100% | 100% | |
| 2 | human | 339745 | SPOPL | speckle type BTB/POZ protei... | XM_005263657.4 | 70.4% | 70.4% | 0_1ins348 |
| 3 | human | 339745 | SPOPL | speckle type BTB/POZ protei... | XM_005263655.5 | 67% | 57.1% | 0_1ins322;157_253del |
| 4 | human | 339745 | SPOPL | speckle type BTB/POZ protei... | XM_005263656.4 | 67% | 57.1% | 0_1ins322;157_253del |
| 5 | mouse | 76857 | Spopl | speckle-type POZ protein-like | NM_029773.2 | 92.5% | 96.4% | (many diffs) |
| 6 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XM_006498414.2 | 92.5% | 96.4% | (many diffs) |
| 7 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XM_017319323.1 | 81% | 81.7% | (many diffs) |
| 8 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XM_006498412.3 | 73.2% | 76.8% | (many diffs) |
| 9 | mouse | 76857 | Spopl | speckle-type POZ protein-like | NM_001165997.1 | 62.3% | 58% | (many diffs) |
| 10 | mouse | 76857 | Spopl | speckle-type POZ protein-like | NM_001165998.1 | 62.3% | 58% | (many diffs) |
| 11 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XM_017319324.1 | 62.3% | 58% | (many diffs) |
| 12 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XM_006498417.3 | 51% | 51.6% | (many diffs) |
| 13 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XR_866024.2 | 38.4% | (many diffs) | |
| 14 | mouse | 76857 | Spopl | speckle-type POZ protein-like | XR_866023.2 | 37.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1242
- ORF length:
- 1176
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tcgggaaccc accccacctc tacctggaga tatgtctact ggtcccatag 121 cagaaagctg gtgttacaca caggttaaag tagtaaaatt ttcctatatg tggaccatta 181 ataacttcag tttttgtcga gaggaaatgg gtgaagtgtt aaaaagttca acattttcat 241 ctggcccaag tgacaaaatg aaatggtgcc tgagggtaaa cccaaaggga ttagatgatg 301 aaagtaaaga ctacttgtcc ttatatttgc ttttagtcag ctgccccaaa agtgaagttc 361 gagcaaaatt caaattttcc cttctgaatg ctaaaaggga agaaacaaaa gcaatggaaa 421 gccaaagagc atatcgattt gtgcaaggga aggactgggg ttttaaaaaa ttcattagaa 481 gggacttttt gcttgatgaa gctaatggtc ttttaccaga tgacaagctt acattatttt 541 gtgaggtgag tgtggtccaa gattcagtaa acatatcagg acatactaat acaaatactt 601 tgaaggtgcc tgagtgtcgt ctagcagaag atttaggtaa tctctgggaa aacacaagat 661 ttacagactg cagttttttc gtgagaggac aagaatttaa agctcataaa tctgtgcttg 721 cagctcgatc tccagttttt aacgccatgt ttgaacatga aatggaagaa agcaaaaaga 781 atcgagtgga aataaatgat ttagaccctg aagtttttaa agaaatgatg agattcattt 841 acacagggag agcaccaaac cttgacaaaa tggctgacaa cttgttGGCA GCTGCAGACA 901 AATATGCACT GGAACGGCTG AAGGTCATGT GCGAAGAAGC TTTGTGTAGT AACCTCTCAG 961 TAGAGAATGT TGCAGATACC CTTGTCCTTG CAGATTTGCA CAGTGCAGAA CAGTTGAAAG 1021 CACAAGCCAT AGACTTTATT AATAGGTGCA GTGTACTTCG ACAACTTGGG TGTAAAGATG 1081 GGAAAAACTG GAACAGCAAC CAAGCAACCG ACATAATGGA AACATCAGGG TGGAAGTCCA 1141 TGATTCAGTC TCACCCTCAT TTAGTAGCAG AAGCCTTTCG AGCACTAGCA TCTGCACAGT 1201 GTCCACAGTT TGGCATTCCA CGCAAACGGC TAAAACAGTC CTGCCCAACT TTCTTGTACA 1261 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1321 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1381 AGGACGAAAT GCAGGGCAGG AAACACACTC GACGCGTTAA GTCgacaatc aacctctgga 1441 ttacaaaatt tgtgaaagat t