Transcript: Mouse NM_001165997.1

Mus musculus speckle-type POZ protein-like (Spopl), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Spopl (76857)
Length:
2858
CDS:
643..1596

Additional Resources:

NCBI RefSeq record:
NM_001165997.1
NBCI Gene record:
Spopl (76857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001165997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098566 GCACAAAGAATCGAGTGGAAA pLKO.1 1124 CDS 100% 4.950 6.930 N Spopl n/a
2 TRCN0000098567 GCAGACAAATATGCACTGGAA pLKO.1 1246 CDS 100% 2.640 3.696 N Spopl n/a
3 TRCN0000098569 CAGTGTCCACAGTTTGGTATT pLKO.1 1549 CDS 100% 10.800 7.560 N Spopl n/a
4 TRCN0000098565 CCCGAAGGATTCCAATACAAA pLKO.1 1643 3UTR 100% 5.625 3.938 N Spopl n/a
5 TRCN0000098568 GCTGGTGTTACACACAGGTTA pLKO.1 382 5UTR 100% 4.950 2.970 N Spopl n/a
6 TRCN0000140284 GCTGGTGTTACACACAGGTTA pLKO.1 382 5UTR 100% 4.950 2.970 N SPOPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001165997.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05463 pDONR223 100% 62.3% 58% None (many diffs) n/a
2 ccsbBroad304_05463 pLX_304 0% 62.3% 58% V5 (many diffs) n/a
3 TRCN0000468146 AATGCAGGGCAGGAAACACACTCG pLX_317 30.6% 62.3% 58% V5 (many diffs) n/a
Download CSV