Construct: ORF TRCN0000468157
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016488.1_s317c1
- Derived from:
- ccsbBroadEn_03438
- DNA Barcode:
- GGGCCCTAGGCCAGCTGCATTATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SGTB (54557)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468157
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54557 | SGTB | small glutamine rich tetrat... | NM_019072.3 | 100% | 100% | |
| 2 | human | 54557 | SGTB | small glutamine rich tetrat... | XM_005248548.3 | 100% | 100% | |
| 3 | human | 54557 | SGTB | small glutamine rich tetrat... | XM_017009597.1 | 73.5% | 69.6% | (many diffs) |
| 4 | mouse | 218544 | Sgtb | small glutamine-rich tetrat... | NM_144838.1 | 87.7% | 96.3% | (many diffs) |
| 5 | mouse | 218544 | Sgtb | small glutamine-rich tetrat... | XM_006517610.2 | 87.7% | 96.3% | (many diffs) |
| 6 | mouse | 218544 | Sgtb | small glutamine-rich tetrat... | XM_006517611.3 | 59.3% | 64.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 978
- ORF length:
- 912
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc atctatcaag cacctggttt atgcagttat tcgtttctta cgggaacaaa 121 gtcagatgga cacttacacc tcggatgaac aagaaagttt ggaagttgca attcagtgct 181 tggagacagt ttttaagatc agcccagaag atacacacct agcagtttca cagcctttga 241 cagaaatgtt taccagttcc ttctgtaaga atgacgttct gcccctttca aactcagtgc 301 ctgaagatgt gggaaaagct gaccaattaa aagatgaagg caataaccac atgaaagaag 361 aaaattatgc tgctgcagtg gattgttaca cacaggcaat agaattggat cccaataatg 421 cagtttacta ttgcaacagg gctgctgctc agagcaaatt aggtcactac acagatgcga 481 taaaggattg tgaaaaagca atagcaattg attcaaagta cagcaaggcc tatgggagaa 541 tggggctggc cctcactgcc ttgaataaat ttGAAGAAGC AGTTACAAGT TATCAAAAGG 601 CATTAGATCT TGACCCTGAA AATGATTCCT ATAAGTCAAA TCTGAAAATA GCAGAACAGA 661 AGTTAAGAGA GGTATCCAGT CCTACAGGAA CTGGACTGAG CTTTGACATG GCTAGCTTGA 721 TAAATAATCC AGCCTTCATT AGTATGGCGG CAAGTTTAAT GCAGAACCCT CAAGTTCAAC 781 AGCTAATGTC AGGAATGATG ACAAATGCCA TTGGGGGACC TGCTGCTGGA GTTGGGGGCC 841 TAACTGACCT GTCAAGCCTC ATCCAAGCGG GACAGCAGTT TGCTCAGCAG ATACAGCAAC 901 AAAATCCTGA ACTTATAGAG CAACTGAGAA ATCACATCCG GAGCAGATCA TTCAGCAGCA 961 GCGCTGAAGA GCATTCCTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 1021 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 1081 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGGGCCCT AGGCCAGCTG 1141 CATTATCACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt