Transcript: Human XM_005248548.3

PREDICTED: Homo sapiens small glutamine rich tetratricopeptide repeat containing beta (SGTB), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SGTB (54557)
Length:
5320
CDS:
88..1002

Additional Resources:

NCBI RefSeq record:
XM_005248548.3
NBCI Gene record:
SGTB (54557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248548.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000416853 CCCTCAAGTTCAACAGCTAAT pLKO_005 789 CDS 100% 10.800 15.120 N SGTB n/a
2 TRCN0000159165 GTTATTCGTTTCTTACGGGAA pLKO.1 118 CDS 100% 2.160 3.024 N SGTB n/a
3 TRCN0000437779 CACATCCGGAGCAGATCATTC pLKO_005 955 CDS 100% 10.800 8.640 N SGTB n/a
4 TRCN0000160101 CTTGATAAATAATCCAGCCTT pLKO.1 738 CDS 100% 2.640 2.112 N SGTB n/a
5 TRCN0000419915 GCCCTCACTGCCTTGAATAAA pLKO_005 571 CDS 100% 15.000 10.500 N SGTB n/a
6 TRCN0000159646 GATTGTTACACACAGGCAATA pLKO.1 403 CDS 100% 10.800 7.560 N SGTB n/a
7 TRCN0000433940 GCAATAGCAATTGATTCAAAG pLKO_005 520 CDS 100% 10.800 7.560 N SGTB n/a
8 TRCN0000159198 GAAGCAGTTACAAGTTATCAA pLKO.1 598 CDS 100% 5.625 3.938 N SGTB n/a
9 TRCN0000158687 GATAAATAATCCAGCCTTCAT pLKO.1 741 CDS 100% 4.950 3.465 N SGTB n/a
10 TRCN0000412785 GTCACCATGCCCAGCTAATTT pLKO_005 2639 3UTR 100% 15.000 7.500 Y TDGF1 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 2841 3UTR 100% 4.950 2.475 Y LOC387873 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3016 3UTR 100% 13.200 6.600 Y LIAS n/a
13 TRCN0000157476 GCCAACATGGTGAAACCCAAT pLKO.1 3089 3UTR 100% 4.050 2.025 Y NFASC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248548.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03438 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03438 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468157 GGGCCCTAGGCCAGCTGCATTATC pLX_317 44.6% 100% 100% V5 n/a
Download CSV