Transcript: Mouse XM_006517610.2

PREDICTED: Mus musculus small glutamine-rich tetratricopeptide repeat (TPR)-containing, beta (Sgtb), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sgtb (218544)
Length:
3844
CDS:
289..1203

Additional Resources:

NCBI RefSeq record:
XM_006517610.2
NBCI Gene record:
Sgtb (218544)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006517610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248787 ATCCCAACAATGCCGTTTATT pLKO_005 632 CDS 100% 15.000 21.000 N Sgtb n/a
2 TRCN0000216843 GATCCCAACAATGCCGTTTAT pLKO.1 631 CDS 100% 13.200 18.480 N Sgtb n/a
3 TRCN0000193985 GTTATTCGTTTCTTGCGGGAA pLKO.1 319 CDS 100% 2.160 3.024 N Sgtb n/a
4 TRCN0000248789 TCCTGAGAATGATTCGTATAA pLKO_005 837 CDS 100% 13.200 10.560 N Sgtb n/a
5 TRCN0000248790 CGACGACGACGATGACTATTT pLKO_005 2016 3UTR 100% 13.200 9.240 N Sgtb n/a
6 TRCN0000248788 TCGCCCTCACTGCCATGAATA pLKO_005 770 CDS 100% 13.200 9.240 N Sgtb n/a
7 TRCN0000176243 GTTCACAAACTCCGTCTGTAA pLKO.1 471 CDS 100% 4.950 3.465 N Sgtb n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006517610.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03438 pDONR223 100% 87.7% 96.3% None (many diffs) n/a
2 ccsbBroad304_03438 pLX_304 0% 87.7% 96.3% V5 (many diffs) n/a
3 TRCN0000468157 GGGCCCTAGGCCAGCTGCATTATC pLX_317 44.6% 87.7% 96.3% V5 (many diffs) n/a
Download CSV