Construct: ORF TRCN0000468197
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002238.1_s317c1
- Derived from:
- ccsbBroadEn_03161
- DNA Barcode:
- TAGCGCTGGATATGCCGGGCACCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FOXP3 (50943)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468197
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 50943 | FOXP3 | forkhead box P3 | NM_014009.4 | 100% | 100% | |
| 2 | human | 50943 | FOXP3 | forkhead box P3 | XM_006724533.2 | 94.9% | 94.9% | 540_608del |
| 3 | human | 50943 | FOXP3 | forkhead box P3 | NM_001114377.2 | 91.8% | 91.8% | 207_208ins105 |
| 4 | human | 50943 | FOXP3 | forkhead box P3 | XM_017029567.1 | 77.9% | 77.9% | 1_51del;258_259ins105;1091_1270del |
| 5 | mouse | 20371 | Foxp3 | forkhead box P3 | NM_001199347.1 | 84.5% | 86.1% | (many diffs) |
| 6 | mouse | 20371 | Foxp3 | forkhead box P3 | NM_001199348.1 | 84.5% | 86.1% | (many diffs) |
| 7 | mouse | 20371 | Foxp3 | forkhead box P3 | NM_054039.2 | 84.5% | 86.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1362
- ORF length:
- 1293
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcccaacccc aggcctggca agccctcggc cccttccttg gcccttggcc 121 catccccagg agcctcgccc agctggaggg ctgcacccaa agcctcagac ctgctggggg 181 cccggggccc agggggaacc ttccagggcc gagatcttcg aggcggggcc catgcctcct 241 cttcttcctt gaaccccatg ccaccatcgc agctgcagct gcccacactg cccctagtca 301 tggtggcacc ctccggggca cggctgggcc ccttgcccca cttacaggca ctcctccagg 361 acaggccaca tttcatgcac cagctctcaa cggtggatgc ccacgcccgg acccctgtgc 421 tgcaggtgca ccccctggag agcccagcca tgatcagcct cacaccaccc accaccgcca 481 ctggggtctt ctccctcaag gcccggcctg gcctcccacc tgggatcaac gtggccagcc 541 tggaatgggt gtccagggag ccggcactgc tctgcacctt cccaaatccc agtgcaccca 601 ggaaggacag caccctttcg gctgtgcccc agagctccta cccactgctg gcaaatggtg 661 tctgcaagtg gcccggatgt gagaaggtct tcgaagagcc agaggacttc ctcaagcact 721 gccaggcgga ccatcttctg gatgagaagg gcagggcaca atgtctcctc cagagagaga 781 tggtacagtc tctggagcag cagctggtgc tggagaagga gaagctgagt gccatgcagg 841 cccacctggc tgggaaaatg gcactgacca aggcttcatc tgtggcatca tccgacaagg 901 gctcctgctg catcgtagct gctggcagcc aaggccctgt cgtcccagcc tggtctggcc 961 cccgggaggc ccctgacagc ctgtttgctg tccggaggca cctgtggggt agccatggaa 1021 acagcacatt cccagagttc ctccacaaca tggactactt caagttccac aacatgcgac 1081 cccctttcac cTACGCCACG CTCATCCGCT GGGCCATCCT GGAGGCTCCA GAGAAGCAGC 1141 GGACACTCAA TGAGATCTAC CACTGGTTCA CACGCATGTT TGCCTTCTTC AGAAACCATC 1201 CTGCCACCTG GAAGAACGCC ATCCGCCACA ACCTGAGTCT GCACAAGTGC TTTGTGCGGG 1261 TGGAGAGCGA GAAGGGGGCT GTGTGGACCG TGGATGAGCT GGAGTTCCGC AAGAAACGGA 1321 GCCAGAGGCC CAGCAGGTGT TCCAACCCTA CACCTGGCCC CTTGCCAACT TTCTTGTACA 1381 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1441 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1501 AGGACGATAG CGCTGGATAT GCCGGGCACC AACGCGTTAA GTCgacaatc aacctctgga 1561 ttacaaaatt tgtgaaagat t