Transcript: Mouse NM_001199348.1

Mus musculus forkhead box P3 (Foxp3), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Foxp3 (20371)
Length:
3690
CDS:
201..1490

Additional Resources:

NCBI RefSeq record:
NM_001199348.1
NBCI Gene record:
Foxp3 (20371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001199348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071987 GACCGTAGATGAATTTGAGTT pLKO.1 1418 CDS 100% 4.950 6.930 N Foxp3 n/a
2 TRCN0000413282 AGAGCCTGCCTTGGTACATTC pLKO_005 1839 3UTR 100% 10.800 8.640 N Foxp3 n/a
3 TRCN0000429560 ACAGACACCATCCTAATATTT pLKO_005 1793 3UTR 100% 15.000 10.500 N Foxp3 n/a
4 TRCN0000358518 TCCTACCCACTGCTGGCAAAT pLKO_005 765 CDS 100% 10.800 7.560 N FOXP3 n/a
5 TRCN0000071986 CAATAGTTCCTTCCCAGAGTT pLKO.1 1151 CDS 100% 4.950 3.465 N Foxp3 n/a
6 TRCN0000071984 CCACACCTCTTCTTCCTTGAA pLKO.1 362 CDS 100% 4.950 3.465 N Foxp3 n/a
7 TRCN0000417788 TACTCGCATGTTCGCCTACTT pLKO_005 1301 CDS 100% 4.950 3.465 N Foxp3 n/a
8 TRCN0000358519 TCCACAACATGGACTACTTCA pLKO_005 1174 CDS 100% 4.950 3.465 N FOXP3 n/a
9 TRCN0000071985 CTTTCACCTATGCCACCCTTA pLKO.1 1216 CDS 100% 4.050 2.835 N Foxp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001199348.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03161 pDONR223 100% 84.5% 86.1% None (many diffs) n/a
2 ccsbBroad304_03161 pLX_304 0% 84.5% 86.1% V5 (many diffs) n/a
3 TRCN0000468197 TAGCGCTGGATATGCCGGGCACCA pLX_317 21.3% 84.5% 86.1% V5 (many diffs) n/a
Download CSV