Construct: ORF TRCN0000468248
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007487.1_s317c1
- Derived from:
- ccsbBroadEn_15951
- DNA Barcode:
- GGCTAATAACTAAATATTGAAAGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FAM234B (57613)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468248
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) | Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) | Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57613 | FAM234B | family with sequence simila... | NM_020853.2 | 99.8% | 100% | 105C>T;1329T>C | 
| 2 | mouse | 74525 | Fam234b | family with sequence simila... | NM_028982.4 | 85.1% | 87.1% | (many diffs) | 
| 3 | mouse | 74525 | Fam234b | family with sequence simila... | XM_006506715.2 | 83.8% | 85.8% | (many diffs) | 
| 4 | mouse | 74525 | Fam234b | family with sequence simila... | XM_017321794.1 | 69.2% | 70.6% | (many diffs) | 
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1935
- ORF length:
- 1866
- Sequence:
- 
          1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgaccgtg ctgtccaggg cgctcaagct gccggggaag aagagcccag 121 acctagggga gtatgatcca cttacccagg ctgacagtga tgagagcgaa gatgatctgg 181 tgcttaacct gcagaagaat ggaggggtca aaaatgggaa gagtcctttg ggagaagcgc 241 cagaacccga ctcagatgct gaggttgcag aggctgcaaa gccacatctt tcagaagtca 301 ccacggaggg ctacccctca gaaccccttg ggggcctgga acagaaggcg gcctcctccc 361 tggtgtcata tgtgcgcacg tctgtcttcc tgctgacttt ggggatctcg atgatcctgg 421 tgctcctgtg tgctttcctg atcccctgtc ctcccagaga tctgcacagc acctggagcc 481 gccacttggg ctcccaggga ggtggggacc tgtctccatt ggaattggct gatgtgaatg 541 gagatggcct gcgtgatgtg cttctctcct ttgtgatgtc aaggaacggg agtgcagtag 601 gtgtctcaag accagctgct aatcttgtat gcctttcggg gatgaatggc agcacactgt 661 ggtctagtct tctccctgag gaggctcgag atatcacatg tttggagctg atgccaggaa 721 gcttggctga aaccatctgc cttgtgacag ggacacacaa gatgctcagc gcattcaatg 781 caacgtcagg gaaagccatt tggactttaa acccaaacta cttgtccaac ggtaccttgg 841 ctgccccagt tgtggtactg ccagacttgg atgaagacgg tgttcgagac cttgtggttc 901 tggccattgg ggaattgcag ccagatctgt gctttctgct ggtgtctggc cggaccggaa 961 atccagtggg tcgacctgtg aagtacaaca tcgttggagt tgggaatctg attggtcctc 1021 aggtttacat caccacaaat ggggctgtct acatcctgtt tggctttgga aatatacaag 1081 ctgtcgcact gcgggacatt tttgttcagg cccaaaatcg agacagctca ccaccttctc 1141 tgcagataga agagccagaa tgggaaaagc gaagatccat caacctgtct gagctcattg 1201 atgtttacag tgatggtgtt gaactactcc agatggtgaa ggcaccagat tccaactgca 1261 gcaaccttct gattacaacc agacaaagcc ttgtgctgct tcgggggcaa aatctgacac 1321 cttactgggc attgagactt caaggcctgc gcagccagcc tactcctgga tatttcactg 1381 atgatcagac attagacttc cttctgcaga tacaggatgg agttgggatg aaaaagatga 1441 tggttgtgga tggtgactct ggctccattg tttggagtta ccgtgctccg tgtcacatga 1501 aagaaacgcc agccacctca gcagttactt cagaccagaa gtctgtcttc ctcttctggg 1561 ccgaagggct gtcagctgca tctcccaatt ccgatatcat cctaggaact gagccgccca 1621 gccttcacca cctttacctc ctgcatcctg cgttcccctc catccttctg gatctggcca 1681 acaccaccgg cacagtgacg gcttcagagg ttGGAATTAA CGACCTCTGG AAAGATGCCT 1741 TTTATGTTAC CAGGACAACA GGGCCAAGCT CCGAAGGCCA TCCAGCAGCC CTGGTGGTCA 1801 GCAAGCTTAG TCTACGGTGG GCACTAATGG AGGGCCAGAT GGCTCAGCTA CAGGAGTCCA 1861 CCCCCAAAAT TGGCCGTGGG GAGCTGCGAA GATTTCTCTC TAGGATAAAG TTTGTTGAAG 1921 CTCCCTACGA GATCTTGCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1981 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 2041 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GGCTAATAAC TAAATATTGA 2101 AAGTACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt 
 
 
              