Transcript: Mouse XM_006506715.2

PREDICTED: Mus musculus family with sequence similarity 234, member B (Fam234b), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam234b (74525)
Length:
4261
CDS:
99..2003

Additional Resources:

NCBI RefSeq record:
XM_006506715.2
NBCI Gene record:
Fam234b (74525)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000345388 ATCGTCTGGAGTTACAGTATT pLKO_005 1533 CDS 100% 13.200 18.480 N Fam234b n/a
2 TRCN0000201650 CGAAGATTCCTGTCTAGGATA pLKO.1 1953 CDS 100% 4.950 6.930 N Fam234b n/a
3 TRCN0000192590 GCCCAGTGTTGTAACAATTAT pLKO.1 2393 3UTR 100% 15.000 10.500 N Fam234b n/a
4 TRCN0000264429 GCCCAGTGTTGTAACAATTAT pLKO_005 2393 3UTR 100% 15.000 10.500 N Fam234b n/a
5 TRCN0000283034 GGCCGACCTGTGAAGTATAAC pLKO_005 1035 CDS 100% 13.200 9.240 N Fam234b n/a
6 TRCN0000264428 TTCAGAGCTCATCGATGTTTA pLKO_005 1253 CDS 100% 13.200 9.240 N Fam234b n/a
7 TRCN0000217856 GCTTAGAGGACAAGATCTTAC pLKO.1 1364 CDS 100% 10.800 7.560 N Fam234b n/a
8 TRCN0000264430 GCTTAGAGGACAAGATCTTAC pLKO_005 1364 CDS 100% 10.800 7.560 N Fam234b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506715.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08747 pDONR223 100% 83.8% 85.8% None (many diffs) n/a
2 ccsbBroad304_08747 pLX_304 0% 83.8% 85.8% V5 (many diffs) n/a
3 TRCN0000481014 TATTTTTAAATTAAAACTCAGATC pLX_317 19.7% 83.8% 85.8% V5 (many diffs) n/a
4 ccsbBroadEn_15951 pDONR223 0% 83.8% 85.8% None (many diffs) n/a
5 ccsbBroad304_15951 pLX_304 0% 83.8% 85.8% V5 (many diffs) n/a
6 TRCN0000468248 GGCTAATAACTAAATATTGAAAGT pLX_317 12.3% 83.8% 85.8% V5 (many diffs) n/a
7 ccsbBroadEn_08748 pDONR223 100% 83.7% 85.6% None (many diffs) n/a
8 ccsbBroad304_08748 pLX_304 0% 83.7% 85.6% V5 (many diffs) n/a
9 TRCN0000479301 ACAAGATATTAACGCTCGGCTGGA pLX_317 18.8% 83.7% 85.6% V5 (many diffs) n/a
Download CSV