Transcript: Human NM_020853.2

Homo sapiens family with sequence similarity 234 member B (FAM234B), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
FAM234B (57613)
Length:
4711
CDS:
24..1892

Additional Resources:

NCBI RefSeq record:
NM_020853.2
NBCI Gene record:
FAM234B (57613)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183125 CGAAGATTTCTCTCTAGGATA pLKO.1 1842 CDS 100% 4.950 6.930 N FAM234B n/a
2 TRCN0000180321 CCAGCCTACTCCTGGATATTT pLKO.1 1310 CDS 100% 15.000 12.000 N FAM234B n/a
3 TRCN0000146714 CGACATCAGAAGTGTATGTTT pLKO.1 2705 3UTR 100% 5.625 3.938 N FAM234B n/a
4 TRCN0000183262 GCTTCTTGAATAACCTTGATA pLKO.1 3142 3UTR 100% 5.625 3.938 N FAM234B n/a
5 TRCN0000180070 CCTCAGATAATCCACCTGCTT pLKO.1 3457 3UTR 100% 2.640 1.320 Y FAM234B n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3484 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3345 3UTR 100% 2.640 1.320 Y LINC01098 n/a
8 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3484 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020853.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08747 pDONR223 100% 99.8% 100% None 561A>G;1329T>C n/a
2 ccsbBroad304_08747 pLX_304 0% 99.8% 100% V5 561A>G;1329T>C n/a
3 TRCN0000481014 TATTTTTAAATTAAAACTCAGATC pLX_317 19.7% 99.8% 100% V5 561A>G;1329T>C n/a
4 ccsbBroadEn_15951 pDONR223 0% 99.8% 100% None 105C>T;1329T>C n/a
5 ccsbBroad304_15951 pLX_304 0% 99.8% 100% V5 105C>T;1329T>C n/a
6 TRCN0000468248 GGCTAATAACTAAATATTGAAAGT pLX_317 12.3% 99.8% 100% V5 105C>T;1329T>C n/a
7 ccsbBroadEn_08748 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
8 ccsbBroad304_08748 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
9 TRCN0000479301 ACAAGATATTAACGCTCGGCTGGA pLX_317 18.8% 99.7% 99.8% V5 (many diffs) n/a
Download CSV