Construct: ORF TRCN0000468405
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004687.1_s317c1
- Derived from:
- ccsbBroadEn_04168
- DNA Barcode:
- GACCCTGGGCAAATATTTATGAAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NRSN2 (80023)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468405
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 80023 | NRSN2 | neurensin 2 | NM_001323680.2 | 100% | 100% | |
| 2 | human | 80023 | NRSN2 | neurensin 2 | NM_001323681.2 | 100% | 100% | |
| 3 | human | 80023 | NRSN2 | neurensin 2 | NM_001323682.2 | 100% | 100% | |
| 4 | human | 80023 | NRSN2 | neurensin 2 | NM_001323683.2 | 100% | 100% | |
| 5 | human | 80023 | NRSN2 | neurensin 2 | NM_001323684.2 | 100% | 100% | |
| 6 | human | 80023 | NRSN2 | neurensin 2 | NM_001323685.2 | 100% | 100% | |
| 7 | human | 80023 | NRSN2 | neurensin 2 | NM_024958.3 | 100% | 100% | |
| 8 | human | 80023 | NRSN2 | neurensin 2 | XM_006723630.4 | 100% | 100% | |
| 9 | human | 80023 | NRSN2 | neurensin 2 | XM_011529360.1 | 100% | 100% | |
| 10 | human | 80023 | NRSN2 | neurensin 2 | XM_011529362.3 | 100% | 100% | |
| 11 | human | 80023 | NRSN2 | neurensin 2 | XM_011529363.2 | 100% | 100% | |
| 12 | human | 80023 | NRSN2 | neurensin 2 | XM_017028073.1 | 100% | 100% | |
| 13 | human | 80023 | NRSN2 | neurensin 2 | XM_017028074.2 | 100% | 100% | |
| 14 | human | 80023 | NRSN2 | neurensin 2 | XM_017028075.1 | 100% | 100% | |
| 15 | human | 80023 | NRSN2 | neurensin 2 | NM_001323679.2 | 78.4% | 78.4% | 285_286ins132 |
| 16 | human | 80023 | NRSN2 | neurensin 2 | NR_136649.2 | 27.2% | (many diffs) | |
| 17 | human | 80023 | NRSN2 | neurensin 2 | XM_017028076.1 | 21.8% | 21.2% | 1_276del;468_468delGinsCAGCCTGTCCT;471_472ins407 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 678
- ORF length:
- 612
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat gccgagctgc aatcgttcct gcagctgcag ccgcggcccc agcgtggagg 121 atggcaagtg gtatggggtc cgctcctacc tgcacctctt ctatgaggac tgtgcaggca 181 ctgctctcag cgacgaccct gagggacctc cggtcctgtg cccccgccgg ccctggccct 241 cactgtgttg gaagatcagc ctgtcctcgg ggaccctgct tctgctgctg ggtgtggcgg 301 ctctgaccac tggctatgca gtgcccccca agctggaggg catcggtgag ggtgagttcc 361 tggtgttGGA TCAGCGGGCA GCCGACTACA ACCAGGCCCT GGGCACCTGT CGCCTGGCAG 421 GCACAGCGCT CTGTGTGGCA GCTGGAGTTC TGCTCGCCAT CTGCCTCTTC TGGGCCATGA 481 TAGGCTGGCT GAGCCAGGAC ACCAAGGCAG AGCCCTTGGA CCCCGAAGCC GACAGCCACG 541 TGGAGGTCTT CGGGGATGAG CCAGAGCAGC AGTTGTCACC CATTTTCCGC AATGCCAGTG 601 GCCAGTCATG GTTCTCGCCA CCCGCCAGCC CCTTTGGGCA ATCTTCTGTG CAGACTATCC 661 AGCCCAAGAG GGACTCCTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 721 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 781 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGAGACCCTG GGCAAATATT 841 TATGAATACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt