Transcript: Human XM_017028074.2

PREDICTED: Homo sapiens neurensin 2 (NRSN2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRSN2 (80023)
Length:
2090
CDS:
243..857

Additional Resources:

NCBI RefSeq record:
XM_017028074.2
NBCI Gene record:
NRSN2 (80023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157740 CCTCACTGTGTTGGAAGATCA pLKO.1 415 CDS 100% 4.950 3.960 N NRSN2 n/a
2 TRCN0000155739 CTCTTCCAAGATACCAGCATT pLKO.1 1030 3UTR 100% 4.950 3.465 N NRSN2 n/a
3 TRCN0000154586 GCAATCTTCTGTGCAGACTAT pLKO.1 815 CDS 100% 4.950 3.465 N NRSN2 n/a
4 TRCN0000156620 GCAGGATGAGTGAAGACGTTT pLKO.1 1330 3UTR 100% 4.950 3.465 N NRSN2 n/a
5 TRCN0000154481 GCTTTGGATCAGATTCCTCTT pLKO.1 1208 3UTR 100% 4.050 2.835 N NRSN2 n/a
6 TRCN0000157641 CTCTTCTATGAGGACTGTGCA pLKO.1 333 CDS 100% 2.640 1.848 N NRSN2 n/a
7 TRCN0000158377 CTTTGGGCAATCTTCTGTGCA pLKO.1 809 CDS 100% 2.640 1.848 N NRSN2 n/a
8 TRCN0000156213 CAATCTTCTGTGCAGACTATC pLKO.1 816 CDS 100% 10.800 6.480 N NRSN2 n/a
9 TRCN0000151490 CAGGAACTAGAAACACATCTT pLKO.1 1499 3UTR 100% 4.950 2.970 N NRSN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028074.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04168 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04168 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468405 GACCCTGGGCAAATATTTATGAAT pLX_317 50.7% 100% 100% V5 n/a
Download CSV