Transcript: Human XM_017028076.1

PREDICTED: Homo sapiens neurensin 2 (NRSN2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRSN2 (80023)
Length:
1252
CDS:
317..790

Additional Resources:

NCBI RefSeq record:
XM_017028076.1
NBCI Gene record:
NRSN2 (80023)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017028076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157641 CTCTTCTATGAGGACTGTGCA pLKO.1 683 CDS 100% 2.640 1.848 N NRSN2 n/a
2 TRCN0000157740 CCTCACTGTGTTGGAAGATCA pLKO.1 765 CDS 100% 4.950 3.960 N NRSN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017028076.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04168 pDONR223 100% 21.8% 21.2% None 1_276del;468_468delGinsCAGCCTGTCCT;471_472ins407 n/a
2 ccsbBroad304_04168 pLX_304 0% 21.8% 21.2% V5 1_276del;468_468delGinsCAGCCTGTCCT;471_472ins407 n/a
3 TRCN0000468405 GACCCTGGGCAAATATTTATGAAT pLX_317 50.7% 21.8% 21.2% V5 1_276del;468_468delGinsCAGCCTGTCCT;471_472ins407 n/a
Download CSV