Construct: ORF TRCN0000468444
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002865.1_s317c1
- Derived from:
- ccsbBroadEn_02398
- DNA Barcode:
- CTTTCCTTTAATTCCACCACGCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LANCL1 (10314)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468444
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10314 | LANCL1 | LanC like 1 | NM_001136574.1 | 100% | 100% | |
| 2 | human | 10314 | LANCL1 | LanC like 1 | NM_001136575.1 | 100% | 100% | |
| 3 | human | 10314 | LANCL1 | LanC like 1 | NM_006055.3 | 100% | 100% | |
| 4 | human | 10314 | LANCL1 | LanC like 1 | XM_005246243.2 | 97% | 97% | 1_36del |
| 5 | mouse | 14768 | Lancl1 | LanC (bacterial lantibiotic... | NM_001190984.1 | 87.3% | 91.4% | (many diffs) |
| 6 | mouse | 14768 | Lancl1 | LanC (bacterial lantibiotic... | NM_001190985.1 | 87.3% | 91.4% | (many diffs) |
| 7 | mouse | 14768 | Lancl1 | LanC (bacterial lantibiotic... | NM_021295.3 | 87.3% | 91.4% | (many diffs) |
| 8 | mouse | 14768 | Lancl1 | LanC (bacterial lantibiotic... | XM_011238435.2 | 77% | 80.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1263
- ORF length:
- 1197
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc tcaaagggcc ttcccgaatc cttatgctga ttataacaaa tccctggccg 121 aaggctactt tgatgctgcc gggaggctga ctcctgagtt ctcacaacgc ttgaccaata 181 agattcggga gcttcttcag caaatggaga gaggcctgaa atcagcagac cctcgggatg 241 gcaccggtta cactggctgg gcaggtattg ctgtgcttta cttacatctt tatgatgtat 301 ttggggaccc tgcctaccta cagttagcac atggctatgt aaagcaaagt ctgaactgct 361 taaccaagcg ctccatcacc ttcctttgtg gggatgcagg ccccctggca gtggccgctg 421 tgctatatca caagatgaac aatgagaagc aggcagaaga ttgcatcaca cggctaattc 481 acctaaataa gattgatcct catgctccaa atgaaatgct ctatgggcga ataggctaca 541 tctatgctct tctttttgtc aataagaact ttggagtgga aaagattcct caaagccata 601 ttcagcagat ttgtgaaaca attttaacct ctggagaaaa cctagctagg aagagaaact 661 tcacggcaaa gtctccactg atgtatgaat ggtaccagga atattatgta ggggctgctc 721 atggcctggc tggaatttat tactacctga tgcagcccag ccttcaagtg agccaaggga 781 agttacatag tttggtcaag ccCAGTGTAG ACTACGTCTG CCAGCTGAAA TTCCCTTCTG 841 GCAATTACCC TCCATGTATA GGTGATAATC GAGATCTGCT TGTCCATTGG TGCCATGGCG 901 CCCCTGGGGT AATCTACATG CTCATCCAGG CCTATAAGGT ATTCAGAGAG GAAAAGTATC 961 TCTGTGATGC CTATCAGTGT GCTGATGTGA TCTGGCAATA TGGGTTGCTG AAGAAGGGAT 1021 ATGGGCTGTG CCACGGTTCT GCAGGGAATG CCTATGCCTT CCTGACACTC TACAACCTCA 1081 CACAGGACAT GAAGTACCTG TATAGGGCCT GTAAGTTTGC TGAATGGTGC TTAGAGTATG 1141 GAGAACATGG ATGCAGAACA CCAGACACCC CTTTCTCTCT CTTTGAAGGA ATGGCTGGAA 1201 CAATATATTT CCTGGCTGAC CTGCTAGTCC CCACAAAAGC CAGGTTCCCT GCATTTGAAC 1261 TCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1321 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1381 GGCTTTATAT ATCTTGTGGA AAGGACGACT TTCCTTTAAT TCCACCACGC CAACGCGTTA 1441 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt