Transcript: Human NM_001136575.1

Homo sapiens LanC like 1 (LANCL1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
LANCL1 (10314)
Length:
4526
CDS:
71..1270

Additional Resources:

NCBI RefSeq record:
NM_001136575.1
NBCI Gene record:
LANCL1 (10314)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001136575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011691 CACGGCTAATTCACCTAAATA pLKO.1 474 CDS 100% 15.000 21.000 N LANCL1 n/a
2 TRCN0000350599 GATTGCATCACACGGCTAATT pLKO_005 464 CDS 100% 13.200 18.480 N LANCL1 n/a
3 TRCN0000011688 GCTCCAAATGAAATGCTCTAT pLKO.1 509 CDS 100% 4.950 6.930 N LANCL1 n/a
4 TRCN0000350598 GCTCCAAATGAAATGCTCTAT pLKO_005 509 CDS 100% 4.950 6.930 N LANCL1 n/a
5 TRCN0000315423 ATGCTCATCCAGGCCTATAAG pLKO_005 923 CDS 100% 13.200 10.560 N LANCL1 n/a
6 TRCN0000011689 GTACCTGTATAGGGCCTGTAA pLKO.1 1099 CDS 100% 0.000 0.000 N LANCL1 n/a
7 TRCN0000011687 CCAAGGAAACAAAGAGTCAAA pLKO.1 1350 3UTR 100% 4.950 3.465 N LANCL1 n/a
8 TRCN0000315452 CCAAGGAAACAAAGAGTCAAA pLKO_005 1350 3UTR 100% 4.950 3.465 N LANCL1 n/a
9 TRCN0000011690 GCTGTGCTTTACTTACATCTT pLKO.1 275 CDS 100% 4.950 3.465 N LANCL1 n/a
10 TRCN0000315451 GCTGTGCTTTACTTACATCTT pLKO_005 275 CDS 100% 4.950 3.465 N LANCL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001136575.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02398 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02398 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468444 CTTTCCTTTAATTCCACCACGCCA pLX_317 38.7% 100% 100% V5 n/a
Download CSV