Transcript: Mouse NM_021295.3

Mus musculus LanC (bacterial lantibiotic synthetase component C)-like 1 (Lancl1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lancl1 (14768)
Length:
4277
CDS:
114..1313

Additional Resources:

NCBI RefSeq record:
NM_021295.3
NBCI Gene record:
Lancl1 (14768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_021295.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222334 GCCCACTTTGTTTAGTTAAAT pLKO.1 3122 3UTR 100% 15.000 21.000 N Lancl1 n/a
2 TRCN0000222338 GCATACAAGGTGTTCAAAGAA pLKO.1 978 CDS 100% 5.625 7.875 N Lancl1 n/a
3 TRCN0000319814 GCATACAAGGTGTTCAAAGAA pLKO_005 978 CDS 100% 5.625 7.875 N Lancl1 n/a
4 TRCN0000222335 CCAAGGAAAGTTGCATAGTTT pLKO.1 821 CDS 100% 5.625 4.500 N Lancl1 n/a
5 TRCN0000350191 CCAAGGAAAGTTGCATAGTTT pLKO_005 821 CDS 100% 5.625 4.500 N Lancl1 n/a
6 TRCN0000222337 CGTACCAAATGAAATGCTCTA pLKO.1 551 CDS 100% 4.050 3.240 N Lancl1 n/a
7 TRCN0000319880 CGTACCAAATGAAATGCTCTA pLKO_005 551 CDS 100% 4.050 3.240 N Lancl1 n/a
8 TRCN0000222336 CGCACAGCTATGTAAAGCAAA pLKO.1 376 CDS 100% 4.950 3.465 N Lancl1 n/a
9 TRCN0000319879 CGCACAGCTATGTAAAGCAAA pLKO_005 376 CDS 100% 4.950 3.465 N Lancl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_021295.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02398 pDONR223 100% 87.3% 91.4% None (many diffs) n/a
2 ccsbBroad304_02398 pLX_304 0% 87.3% 91.4% V5 (many diffs) n/a
3 TRCN0000468444 CTTTCCTTTAATTCCACCACGCCA pLX_317 38.7% 87.3% 91.4% V5 (many diffs) n/a
Download CSV