Construct: ORF TRCN0000468474
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002162.1_s317c1
- Derived from:
- ccsbBroadEn_03428
- DNA Barcode:
- TACTATACCCGCGTGGCTGACGCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- EXOSC4 (54512)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468474
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54512 | EXOSC4 | exosome component 4 | NM_019037.3 | 100% | 100% | |
| 2 | human | 54512 | EXOSC4 | exosome component 4 | XM_011517134.3 | 60% | 60% | 0_1ins294 |
| 3 | mouse | 109075 | Exosc4 | exosome component 4 | NM_175399.4 | 87.4% | 95.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 801
- ORF length:
- 735
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggggctggag ctcttgtcgg accagggcta ccgggtggac gggcggcgcg 121 ccggggagct gcgcaagatc caggcgcgga tgggcgtgtt cgcgcaggct gacggctcgg 181 cctacattga gcagggcaac accaaggcac tggctgtggt ctacggcccg cacgagatcc 241 ggggctcccg ggctcgagcc ctgccggaca gggccctagt gaactgtcaa tatagttcag 301 cgaccttcag cacaggtgag cgcaagcgac ggccacatgg ggaccgtaag tcctgtgaga 361 tgggcctgca gctccgccag actttcgaag cagccatcct cacacagctg cacccacgct 421 cccagattga tatctatgtg caggtgctac aggcagatgg tgggacctat gcagcttgtg 481 tgaatgcagc cacgctggca gtgctggatg ccgggatacc catgagagac tttgtgtgtg 541 cgtgctcagc tggcttcgtg gacggcacag ccctggcgga cctcagccat gtggaggaag 601 cagctgGTGG CCCCCAGCTG GCCCTGGCCC TGCTGCCAGC CTCAGGACAG ATTGCGCTGC 661 TTGAGATGGA TGCCCGGCTG CACGAGGACC ACCTGGAGCG GGTGTTGGAG GCTGCTGCCC 721 AGGCTGCCCG AGATGTGCAC ACCCTCTTAG ATCGAGTGGT CCGGCAGCAT GTGCGTGAGG 781 CCTCTATCTT GCTGGGGGAC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 841 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 901 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGATACT ATACCCGCGT 961 GGCTGACGCG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt