Transcript: Mouse NM_175399.4

Mus musculus exosome component 4 (Exosc4), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Exosc4 (109075)
Length:
1789
CDS:
97..834

Additional Resources:

NCBI RefSeq record:
NM_175399.4
NBCI Gene record:
Exosc4 (109075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_175399.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000375326 GGATACCTATGCGGGACTTTG pLKO_005 545 CDS 100% 10.800 15.120 N Exosc4 n/a
2 TRCN0000111350 CCAGATATTAGGGTCCGCAAA pLKO.1 1002 3UTR 100% 4.050 5.670 N Exosc4 n/a
3 TRCN0000354153 CCAGATATTAGGGTCCGCAAA pLKO_005 1002 3UTR 100% 4.050 5.670 N Exosc4 n/a
4 TRCN0000111352 AGACCGGAAGTCTTGTGAGAT pLKO.1 372 CDS 100% 4.950 3.960 N Exosc4 n/a
5 TRCN0000375325 CCAGATCGCACTGCTTGAGAT pLKO_005 678 CDS 100% 4.950 3.465 N Exosc4 n/a
6 TRCN0000111351 CCGCTCTCAGATCGACATCTA pLKO.1 447 CDS 100% 4.950 3.465 N Exosc4 n/a
7 TRCN0000332519 CCGCTCTCAGATCGACATCTA pLKO_005 447 CDS 100% 4.950 3.465 N Exosc4 n/a
8 TRCN0000111353 TCAGTACAGTTCAGCCACCTT pLKO.1 318 CDS 100% 2.640 1.584 N Exosc4 n/a
9 TRCN0000111354 GCAGGCCGATGGCTCGGCTTA pLKO.1 195 CDS 100% 0.000 0.000 N Exosc4 n/a
10 TRCN0000354152 GCAGGCCGATGGCTCGGCTTA pLKO_005 195 CDS 100% 0.000 0.000 N Exosc4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_175399.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03428 pDONR223 100% 87.4% 95.9% None (many diffs) n/a
2 ccsbBroad304_03428 pLX_304 0% 87.4% 95.9% V5 (many diffs) n/a
3 TRCN0000468474 TACTATACCCGCGTGGCTGACGCG pLX_317 27.1% 87.4% 95.9% V5 (many diffs) n/a
Download CSV