Transcript: Human NM_019037.3

Homo sapiens exosome component 4 (EXOSC4), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
EXOSC4 (54512)
Length:
842
CDS:
58..795

Additional Resources:

NCBI RefSeq record:
NM_019037.3
NBCI Gene record:
EXOSC4 (54512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_019037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051364 CGCTCCCAGATTGATATCTAT pLKO.1 409 CDS 100% 5.625 7.875 N EXOSC4 n/a
2 TRCN0000300993 CGCTCCCAGATTGATATCTAT pLKO_005 409 CDS 100% 5.625 7.875 N EXOSC4 n/a
3 TRCN0000051367 GATACCCATGAGAGACTTTGT pLKO.1 507 CDS 100% 4.950 6.930 N EXOSC4 n/a
4 TRCN0000301067 GATACCCATGAGAGACTTTGT pLKO_005 507 CDS 100% 4.950 6.930 N EXOSC4 n/a
5 TRCN0000051366 GATATCTATGTGCAGGTGCTA pLKO.1 421 CDS 100% 2.640 3.696 N EXOSC4 n/a
6 TRCN0000051365 TCAATATAGTTCAGCGACCTT pLKO.1 279 CDS 100% 2.640 3.696 N EXOSC4 n/a
7 TRCN0000300994 TCAATATAGTTCAGCGACCTT pLKO_005 279 CDS 100% 2.640 3.696 N EXOSC4 n/a
8 TRCN0000051363 GCCCTAGTGAACTGTCAATAT pLKO.1 265 CDS 100% 13.200 9.240 N EXOSC4 n/a
9 TRCN0000300992 GCCCTAGTGAACTGTCAATAT pLKO_005 265 CDS 100% 13.200 9.240 N EXOSC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_019037.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03428 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03428 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468474 TACTATACCCGCGTGGCTGACGCG pLX_317 27.1% 100% 100% V5 n/a
Download CSV