Construct: ORF TRCN0000468493
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005558.1_s317c1
- Derived from:
- ccsbBroadEn_08725
- DNA Barcode:
- TCAGATATGTATACACACTATTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- CYP20A1 (57404)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468493
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_177538.3 | 99.7% | 99.3% | 290C>T;370A>G;1036C>T |
| 2 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371695.1 | 98% | 97.6% | (many diffs) |
| 3 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | XM_006712644.4 | 94.9% | 94.1% | (many diffs) |
| 4 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | XM_006712645.3 | 85.7% | 85.2% | (many diffs) |
| 5 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371696.1 | 77.7% | 77.4% | 0_1ins306;64A>G;730C>T |
| 6 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371697.1 | 77.7% | 77.4% | 0_1ins306;64A>G;730C>T |
| 7 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371698.1 | 77.7% | 77.4% | 0_1ins306;64A>G;730C>T |
| 8 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371699.1 | 63.7% | 63.6% | 0_1ins501;535C>T |
| 9 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371700.1 | 63.7% | 63.4% | (many diffs) |
| 10 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371701.1 | 63.7% | 63.4% | (many diffs) |
| 11 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | XR_001738857.1 | 63.2% | (many diffs) | |
| 12 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371702.1 | 50.5% | 50.4% | 0_1ins684;352C>T |
| 13 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371703.1 | 50.5% | 50.4% | 0_1ins684;352C>T |
| 14 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371704.1 | 50.5% | 50.4% | 0_1ins684;352C>T |
| 15 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371705.1 | 50.5% | 50.4% | 0_1ins684;352C>T |
| 16 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NM_001371706.1 | 50.5% | 50.4% | 0_1ins684;352C>T |
| 17 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NR_163985.1 | 12% | (many diffs) | |
| 18 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NR_163981.1 | 11.9% | (many diffs) | |
| 19 | human | 57404 | CYP20A1 | cytochrome P450 family 20 s... | NR_163982.1 | 11.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1452
- ORF length:
- 1386
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtt ggacttcgcg atcttcgccg ttaccttctt gctggcgttg gtgggagccg 121 tgctctacct ctatccggct tccagacaag ctgcaggaat tccagggatt actccaactg 181 aagaaaaaga tggtaatctt ccagatattg tgaatagtgg aagtttgcat gagttcctgg 241 ttaatttgca tgagagatat gggcctgtgg tctccttctg gtttggcagg cgcctcgtgg 301 ttagtttggg cactgttgat gtactgaagc agcatatcaa tcccaataag acattggacc 361 cttttgaaac catgctgaag tcattattaa ggtatcaatc tggtggtggc agtgtgagtg 421 aaaaccacat gagggaaaaa ttgtatgaaa atggtgtgac tgattctctg aagagtaact 481 ttgccctcct cctaaagctt tcagaagaat tattagataa atggctctcc tacccagaga 541 cccagcacgt gcccctcagc cagcatatgc ttggttttgc tatgaagtct gttacacaga 601 tggtaatggg tagtacattt gaagatgatc aggaagtcat tcgcttccag aagaatcatg 661 gcacagtttg gtctgagatt ggaaaaggct ttctagatgg gtcacttgat aaaaacatga 721 ctcggaaaaa acaatatgaa gatgccctca tgcaactgga gtctgtttta aggaacatca 781 taaaagaacg aaaaggaagg aacttcagtc aacatatttt cattgactcc ttagtacaag 841 ggaaccttaa tgaccaacag atcctagaag acagtatgat attttctctg gccagttgca 901 taataactgc aaaattgtgt acctgggcaa tctgtttttt aaccaccTCT GAAGAAGTTC 961 AAAAAAAATT ATATGAAGAG ATAAACCAAG TTTTTGGAAA TGGTCCTGTT ACTCCAGAGA 1021 AAATTGAGCA GCTCAGATAT TGTCAGCATG TGCTTTGTGA AACTGTTCGA ACTGCCAAAC 1081 TGACTCCAGT TTCTGCCCAG TTTCAAGATA TTGAAGGAAA AATTGACCGA TTTATTATTC 1141 CTAGAGAGAC CCTCGTCCTT TATGCCCTTG GTGTGGTACT TCAGGATCCT AATACTTGGC 1201 CATCTCCACA CAAGTTTGAT CCAGATCGGT TTGATGATGA ATTAGTAATG AAAACTTTTT 1261 CCTCACTTGG ATTCTCAGGC ACACAGGAGT GTCCAGAGTT GAGGTTTGCA TATATGGTGA 1321 CCACAGTACT TCTTAGTGTA TTGGTGAAGA GACTGCACCT ACTTTCTGTG GAGGGACAGG 1381 TTATTGAAAC AAAGTATGAA CTGGTAACAT CATCAAGGGA AGAAGCTTGG ATCACTGTCT 1441 CAAAGAGATA TTACCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1501 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1561 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGATCA GATATGTATA CACACTATTG 1621 TACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t