Transcript: Human XM_006712645.3

PREDICTED: Homo sapiens cytochrome P450 family 20 subfamily A member 1 (CYP20A1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP20A1 (57404)
Length:
1491
CDS:
82..1275

Additional Resources:

NCBI RefSeq record:
XM_006712645.3
NBCI Gene record:
CYP20A1 (57404)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006712645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271443 GATCGGTTTGATGATGAATTA pLKO_005 1045 CDS 100% 13.200 18.480 N CYP20A1 n/a
2 TRCN0000064133 CCAGGGATTACTCCAACTGAA pLKO.1 178 CDS 100% 4.950 6.930 N CYP20A1 n/a
3 TRCN0000064134 GCTGAAGTCATTATTAAGGTA pLKO.1 390 CDS 100% 3.000 4.200 N CYP20A1 n/a
4 TRCN0000176235 GCATGAGTTCCTGGTTAATTT pLKO.1 243 CDS 100% 15.000 10.500 N Cyp20a1 n/a
5 TRCN0000064136 GATGGTAATCTTCCAGATATT pLKO.1 205 CDS 100% 13.200 9.240 N CYP20A1 n/a
6 TRCN0000271445 TCTGTGGAGGGACAGGTTATT pLKO_005 1186 CDS 100% 13.200 9.240 N CYP20A1 n/a
7 TRCN0000064135 CCTAAAGCTTTCAGAAGAATT pLKO.1 507 CDS 100% 0.000 0.000 N CYP20A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006712645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08724 pDONR223 100% 85.7% 85.4% None 290C>T;600_601ins195;841C>T n/a
2 ccsbBroad304_08724 pLX_304 0% 85.7% 85.4% V5 290C>T;600_601ins195;841C>T n/a
3 TRCN0000492151 TAACGACGCTCTCCTAGTGCACCA pLX_317 29.9% 85.7% 85.4% V5 290C>T;600_601ins195;841C>T n/a
4 ccsbBroadEn_08725 pDONR223 100% 85.7% 85.2% None (many diffs) n/a
5 ccsbBroad304_08725 pLX_304 0% 85.7% 85.2% V5 (many diffs) n/a
6 TRCN0000468493 TCAGATATGTATACACACTATTGT pLX_317 36.6% 85.7% 85.2% V5 (many diffs) n/a
Download CSV