Construct: ORF TRCN0000468497
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF002433.1_s317c1
- Derived from:
- ccsbBroadEn_02571
- DNA Barcode:
- AAGCTCCCAATCTCAGCATTACCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TOMM34 (10953)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468497
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 10953 | TOMM34 | translocase of outer mitoch... | NM_006809.5 | 100% | 100% | |
2 | human | 10953 | TOMM34 | translocase of outer mitoch... | XM_011528501.1 | 88.4% | 87% | (many diffs) |
3 | human | 10953 | TOMM34 | translocase of outer mitoch... | XM_005260254.2 | 66.9% | 66.9% | 0_1ins306 |
4 | human | 10953 | TOMM34 | translocase of outer mitoch... | XM_017027600.2 | 60.9% | 59.8% | (many diffs) |
5 | human | 10953 | TOMM34 | translocase of outer mitoch... | XR_244131.3 | 39% | 1_92del;640_641ins148;872_1849del | |
6 | mouse | 67145 | Tomm34 | translocase of outer mitoch... | NM_025996.5 | 88.5% | 88% | (many diffs) |
7 | mouse | 67145 | Tomm34 | translocase of outer mitoch... | XM_006500067.1 | 88.5% | 88% | (many diffs) |
8 | mouse | 67145 | Tomm34 | translocase of outer mitoch... | NM_001291155.1 | 87.7% | 87% | (many diffs) |
9 | mouse | 67145 | Tomm34 | translocase of outer mitoch... | XR_374511.3 | 35% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 993
- ORF length:
- 927
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ccccaaattc ccagactctg tggaggagct ccgcgccgcc ggcaatgaga 121 gtttccgcaa cggccagtac gccgaggcct ccgcgctcta cggccgcgcg ctgcgggtgc 181 tgcaggcgca aggttcttca gacccagaag aagaaagtgt tctctactcc aaccgagcag 241 catgtcactt gaaggatgga aactgcagag actgcatcaa agattgcact tcagcactgg 301 ccttggttcc cttcagcatt aagcccctgc tgcggcgagc atctgcttat gaggctctgg 361 agaagtaccc tatggcctat gttgactata agactgtgct gcagattgat gataatgtga 421 cgtcagccgt agaaggcatc aacagaatga ccagagctct catggactcg cttgggcctg 481 agtggcgcct gaagctgccc tcaatcccct tggtgcctgt ttcagctcag aagaggtgga 541 attccttgcc ttcggagaac cacaaagaga tggctaaaag caaaTCCAAA GAAACCACAG 601 CTACAAAGAA CAGAGTGCCT TCTGCTGGGG ATGTGGAGAA AGCCAGAGTT CTGAAGGAAG 661 AAGGCAATGA GCTTGTAAAG AAGGGAAACC ATAAGAAAGC TATTGAGAAG TACAGTGAAA 721 GCCTCTTGTG TAGTAACCTG GAATCTGCCA CGTACAGCAA CAGAGCACTC TGCTATTTGG 781 TCCTGAAGCA GTACACAGAA GCAGTGAAGG ACTGCACAGA AGCCCTCAAG CTGGATGGAA 841 AGAACGTGAA GGCATTCTAC AGACGGGCTC AAGCCCACAA AGCACTCAAG GACTATAAAT 901 CCAGCTTTGC AGACATCAGC AACCTCCTAC AGATTGAGCC TAGGAATGGT CCTGCACAGA 961 AGTTGCGGCA GGAAGTGAAG CAGAACCTAC ACTACCCAAC TTTCTTGTAC AAAGTGGTTG 1021 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1081 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAAA 1141 GCTCCCAATC TCAGCATTAC CCACGCGTTA AGTCgacaat caacctctgg attacaaaat 1201 ttgtgaaaga tt