Transcript: Human XR_244131.3

PREDICTED: Homo sapiens translocase of outer mitochondrial membrane 34 (TOMM34), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TOMM34 (10953)
Length:
1849
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_244131.3
NBCI Gene record:
TOMM34 (10953)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_244131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000162421 CGGGCTTCATAGTTCTTTGTA pLKO.1 1662 3UTR 100% 5.625 3.938 N TOMM34 n/a
2 TRCN0000166639 CCGGGCTTCATAGTTCTTTGT pLKO.1 1661 3UTR 100% 4.950 3.465 N TOMM34 n/a
3 TRCN0000292356 CCGGGCTTCATAGTTCTTTGT pLKO_005 1661 3UTR 100% 4.950 3.465 N TOMM34 n/a
4 TRCN0000164891 GCAGTACACAGAAGCAGTGAA pLKO.1 667 3UTR 100% 4.950 3.465 N TOMM34 n/a
5 TRCN0000343896 GCAGTACACAGAAGCAGTGAA pLKO_005 667 3UTR 100% 4.950 3.465 N TOMM34 n/a
6 TRCN0000165176 GTCCTGAAGCAGTACACAGAA pLKO.1 659 3UTR 100% 4.950 3.465 N TOMM34 n/a
7 TRCN0000165865 GCAGCATGTCACTTGAAGGAT pLKO.1 264 3UTR 100% 3.000 2.100 N TOMM34 n/a
8 TRCN0000292355 GCAGCATGTCACTTGAAGGAT pLKO_005 264 3UTR 100% 3.000 2.100 N TOMM34 n/a
9 TRCN0000162053 GATCCTCATCAGCAAAGCATT pLKO.1 1164 3UTR 100% 4.950 2.970 N TOMM34 n/a
10 TRCN0000292357 GATCCTCATCAGCAAAGCATT pLKO_005 1164 3UTR 100% 4.950 2.970 N TOMM34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_244131.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02571 pDONR223 100% 39% None 1_92del;640_641ins148;872_1849del n/a
2 ccsbBroad304_02571 pLX_304 0% 39% V5 1_92del;640_641ins148;872_1849del n/a
3 TRCN0000468497 AAGCTCCCAATCTCAGCATTACCC pLX_317 44.2% 39% V5 1_92del;640_641ins148;872_1849del n/a
Download CSV