Transcript: Mouse XR_374511.3

PREDICTED: Mus musculus translocase of outer mitochondrial membrane 34 (Tomm34), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tomm34 (67145)
Length:
1789
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374511.3
NBCI Gene record:
Tomm34 (67145)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114198 GCAGTACAAGGAGGCAGTAAA pLKO.1 717 3UTR 100% 13.200 9.240 N Tomm34 n/a
2 TRCN0000309384 GCAGTACAAGGAGGCAGTAAA pLKO_005 717 3UTR 100% 13.200 9.240 N Tomm34 n/a
3 TRCN0000114199 CTACAAATTGAACCCAGGAAT pLKO.1 856 3UTR 100% 4.950 3.465 N Tomm34 n/a
4 TRCN0000309386 CTACAAATTGAACCCAGGAAT pLKO_005 856 3UTR 100% 4.950 3.465 N Tomm34 n/a
5 TRCN0000114197 GCAGGAAGTTAACCAGAACAT pLKO.1 897 3UTR 100% 4.950 3.465 N Tomm34 n/a
6 TRCN0000309319 GCAGGAAGTTAACCAGAACAT pLKO_005 897 3UTR 100% 4.950 3.465 N Tomm34 n/a
7 TRCN0000114196 CGATGTTCAAAGAGCCCAGAT pLKO.1 1573 3UTR 100% 4.050 2.835 N Tomm34 n/a
8 TRCN0000309385 CGATGTTCAAAGAGCCCAGAT pLKO_005 1573 3UTR 100% 4.050 2.835 N Tomm34 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374511.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02571 pDONR223 100% 35% None (many diffs) n/a
2 ccsbBroad304_02571 pLX_304 0% 35% V5 (many diffs) n/a
3 TRCN0000468497 AAGCTCCCAATCTCAGCATTACCC pLX_317 44.2% 35% V5 (many diffs) n/a
Download CSV