Construct: ORF TRCN0000468509
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF011109.1_s317c1
- Derived from:
- ccsbBroadEn_14129
- DNA Barcode:
- GCAATACGGGCGACGGAGCATTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SCAPER (49855)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468509
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_011521656.3 | 37.1% | 37% | 1_1482del;2340C>A |
| 2 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022277.2 | 26% | 26% | 1_2481del;3339C>A |
| 3 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022278.2 | 26% | 26% | 1_2481del;3339C>A |
| 4 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022275.2 | 25.9% | 25.8% | 1_2499del;3357C>A |
| 5 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022276.1 | 25.9% | 25.8% | 1_2499del;3357C>A |
| 6 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_001145923.1 | 25.2% | 25.2% | 1_2586del;3444C>A |
| 7 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_024449939.1 | 25.2% | 25.2% | 1_2586del;3444C>A |
| 8 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_024449938.1 | 25.1% | 25% | 1_2604del;3462C>A |
| 9 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_001353010.2 | 23% | 22.9% | 1_2922del;3780C>A |
| 10 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_001353012.2 | 23% | 22.9% | 1_2922del;3780C>A |
| 11 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022273.1 | 23% | 22.9% | 1_2922del;3780C>A |
| 12 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_001353011.2 | 22.9% | 22.8% | 1_2940del;3798C>A |
| 13 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_011521653.3 | 22.9% | 22.8% | 1_2940del;3798C>A |
| 14 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_020843.4 | 20.8% | 20.7% | 1_3324del;4182C>A |
| 15 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022269.1 | 20.8% | 20.7% | 1_3324del;4182C>A |
| 16 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022270.1 | 20.8% | 20.7% | 1_3324del;4182C>A |
| 17 | human | 49855 | SCAPER | S-phase cyclin A associated... | NM_001353009.2 | 20.7% | 20.6% | 1_3342del;4200C>A |
| 18 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_005254417.2 | 20.7% | 20.6% | 1_3342del;4200C>A |
| 19 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022268.1 | 20.7% | 20.6% | 1_3342del;4200C>A |
| 20 | human | 49855 | SCAPER | S-phase cyclin A associated... | XM_017022272.1 | 20% | 18.6% | (many diffs) |
| 21 | human | 49855 | SCAPER | S-phase cyclin A associated... | XR_002957646.1 | 19.1% | 1_3261del;4119C>A;4138_4577del | |
| 22 | human | 49855 | SCAPER | S-phase cyclin A associated... | NR_148227.2 | 17% | 1_3532del;4390C>A;4409_5140del | |
| 23 | mouse | 244891 | Scaper | S phase cyclin A-associated... | XM_006511166.3 | 18.5% | 18.1% | (many diffs) |
| 24 | mouse | 244891 | Scaper | S phase cyclin A-associated... | NM_001081341.1 | 18.5% | 18% | (many diffs) |
| 25 | mouse | 244891 | Scaper | S phase cyclin A-associated... | XM_011242747.2 | 18.5% | 18% | (many diffs) |
| 26 | mouse | 244891 | Scaper | S phase cyclin A-associated... | XM_011242748.2 | 18.5% | 18% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 942
- ORF length:
- 876
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg tctgattgac aaactgtgtg cctgcttcct ctcggtgcaa ggcccagtgg 121 atgagaatcc caagatggcc atatttctgc agcatgccgc aggactctta catgcaatgt 181 gtacactgtg ctttgctgtc actggaaggt catacagcat atttgacaat aatcgccagg 241 atcccacagg gctgacagct gctcttcagg caaccgacct ggctggagtt cttcatatgc 301 tctactgtgt cctcttccat ggcaccatct tggaccccag cactgccagt cccaaggaga 361 attacactca aaataccatc caagtggcca ttcagagttt acgtttcttc aacagctttg 421 cagctcttca tctgcctgct tttcagtcta ttgtaggggc agagggcttg tcccttgcat 481 tccggcacat ggccagctcc ctgctgggcc actgcagcca agtctcctgt gaaagcctcc 541 ttcatgaggt catcgtctgt gtgggctact tcactgtcaa ccacccagat aaccaggtga 601 tcgtgcagtc cggccgccac cccacagtgc tgcagaagct ctgccagttg cccttccagt 661 atttcagtga cccacggctg atcaaagtac tgttcccttc acttATCGCT GCTTGTTACA 721 ACAACCATCA GAACAAGATC ATTCTGGAGC AAGAGATGAG CTGTGTTTTA CTGGCCACTT 781 TCATTCAGGA TTTGGCACAG ACTCCAGGTC AAGCGGAAAA CCAGCCTTAC CAACCCAAAG 841 GGAAATGCCT TGGTTCCCAA GACTATCTTG AGCTGGCTAA CAGATTTCCT CAGCAGGCCT 901 GGGAAGAAGC TCGACAGTTT TTATTGAAAA AAGAGAAAAA ATACCCAACT TTCTTGTACA 961 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 1021 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 1081 AGGACGAGCA ATACGGGCGA CGGAGCATTA GACGCGTTAA GTCgacaatc aacctctgga 1141 ttacaaaatt tgtgaaagat t