Transcript: Human XM_011521656.3

PREDICTED: Homo sapiens S-phase cyclin A associated protein in the ER (SCAPER), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SCAPER (49855)
Length:
2872
CDS:
75..2435

Additional Resources:

NCBI RefSeq record:
XM_011521656.3
NBCI Gene record:
SCAPER (49855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011521656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373599 ATACACCAGTTGACGGTTTAT pLKO_005 1296 CDS 100% 13.200 18.480 N SCAPER n/a
2 TRCN0000159166 GACTGTAGATACTTGAATGTT pLKO.1 2585 3UTR 100% 5.625 4.500 N SCAPER n/a
3 TRCN0000161016 GCCCAGAATAAACGTCATGAT pLKO.1 132 CDS 100% 4.950 3.960 N SCAPER n/a
4 TRCN0000378988 GCATGTACTTTACACTATTTA pLKO_005 2560 3UTR 100% 15.000 10.500 N SCAPER n/a
5 TRCN0000159199 GCTAAGGAATATGAGAGTTTA pLKO.1 879 CDS 100% 13.200 9.240 N SCAPER n/a
6 TRCN0000164331 CGCAGGACTCTTACATGCAAT pLKO.1 1649 CDS 100% 4.950 3.465 N SCAPER n/a
7 TRCN0000159598 GCATTTGTGATATGGGTGAAA pLKO.1 2696 3UTR 100% 4.950 3.465 N SCAPER n/a
8 TRCN0000162742 CCCATGTTTATACTCTTCCCA pLKO.1 2526 3UTR 100% 0.750 0.525 N SCAPER n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011521656.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14129 pDONR223 100% 37.1% 37% None 1_1482del;2340C>A n/a
2 ccsbBroad304_14129 pLX_304 0% 37.1% 37% V5 1_1482del;2340C>A n/a
3 TRCN0000468509 GCAATACGGGCGACGGAGCATTAG pLX_317 27.6% 37.1% 37% V5 1_1482del;2340C>A n/a
Download CSV