Transcript: Mouse XM_011242747.2

PREDICTED: Mus musculus S phase cyclin A-associated protein in the ER (Scaper), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Scaper (244891)
Length:
5258
CDS:
173..4369

Additional Resources:

NCBI RefSeq record:
XM_011242747.2
NBCI Gene record:
Scaper (244891)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011242747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218851 AGTAAGCCTTTGTACTATTTG pLKO_005 4759 3UTR 100% 13.200 18.480 N Scaper n/a
2 TRCN0000225898 ATACACCAATTGACGGTTTAT pLKO_005 3233 CDS 100% 13.200 18.480 N Scaper n/a
3 TRCN0000225897 TGGCTCCGAGTCACCTTATAA pLKO_005 2854 CDS 100% 15.000 10.500 N Scaper n/a
4 TRCN0000225896 GAATGATGTTCTCGCAGATTA pLKO_005 1639 CDS 100% 13.200 9.240 N Scaper n/a
5 TRCN0000225895 GACAATTCAAGGCACTCATAA pLKO_005 334 CDS 100% 13.200 9.240 N Scaper n/a
6 TRCN0000159405 GCAGTAGATGAAATCTATGTA pLKO.1 506 CDS 100% 5.625 3.375 N SCAPER n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011242747.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14129 pDONR223 100% 18.5% 18% None (many diffs) n/a
2 ccsbBroad304_14129 pLX_304 0% 18.5% 18% V5 (many diffs) n/a
3 TRCN0000468509 GCAATACGGGCGACGGAGCATTAG pLX_317 27.6% 18.5% 18% V5 (many diffs) n/a
Download CSV