Construct: ORF TRCN0000468558
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003725.1_s317c1
- Derived from:
- ccsbBroadEn_08422
- DNA Barcode:
- CCTTAGTATTGTCCATTTGACTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GDPD2 (54857)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468558
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | NM_017711.3 | 99.9% | 100% | 1539A>G |
| 2 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | NM_001171192.1 | 91.2% | 91.3% | 1308_1460del;1692A>G |
| 3 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | NM_001171191.1 | 85.2% | 85.3% | 0_1ins237;1302A>G |
| 4 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | NM_001171193.1 | 85.2% | 85.3% | 0_1ins237;1302A>G |
| 5 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | XM_011530977.1 | 76.3% | 76.4% | 0_1ins381;1158A>G |
| 6 | human | 54857 | GDPD2 | glycerophosphodiester phosp... | XM_017029614.1 | 60.2% | 60.2% | 0_1ins642;897A>G |
| 7 | mouse | 71584 | Gdpd2 | glycerophosphodiester phosp... | NM_001305941.1 | 86.1% | 84.8% | (many diffs) |
| 8 | mouse | 71584 | Gdpd2 | glycerophosphodiester phosp... | NM_023608.4 | 86.1% | 84.8% | (many diffs) |
| 9 | mouse | 71584 | Gdpd2 | glycerophosphodiester phosp... | XM_006528295.1 | 86.1% | 84.8% | (many diffs) |
| 10 | mouse | 71584 | Gdpd2 | glycerophosphodiester phosp... | XM_006528297.3 | 52.7% | 51.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1683
- ORF length:
- 1617
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cgagtccccc ggctgctgct ccgtctgggc ccgctgcctc cactgcctgt 121 atagctgcca ctggaggaaa tgccccagag agaggatgca aaccagcaag tgcgactgta 181 tctggtttgg cctgctcttc ctcaccttcc tcctttccct gagctggctg tacatcgggc 241 tcgtccttct caatgacctg cacaacttca atgaattcct cttccgccgc tggggacact 301 ggatggactg gtccctggca ttcctgctgg tcatctctct actggtcaca tatgcatcct 361 tgctattggt cctggccctg ctcctgcggc tttgtagaca gcccctgcat ctgcacagcc 421 tccacaaggt gctgctgctc ctcattatgc tgcttgtggc ggctggcctt gtgggactgg 481 acatccaatg gcagcaggag tggcatagct tgcgtgtgtc actgcaggcc acagccccat 541 tccttcatat tggagcagcc gctggaattg ccctcctggc ctggcctgtg gctgatacct 601 tctaccgtat ccaccgaaga ggtcccaaga ttctgctact gctcctattt tttggagttg 661 tcctggtcat ctacttggcc cccctatgca tctcctcacc ctgcatcatg gaacccagag 721 acttaccacc caagcctggg ctggtgggac accgaggggc ccccatgctg gctcccgaga 781 acaccctgat gtccttgcgg aagacagctg aatgcggagc tactgtgttt gagactgatg 841 tgatggtcag ctccgatggg gtccccttcc tcatgcatga tgagcacctc agcaggacca 901 cgaatgtagc ctctgtattc ccaacccgaa tcacagccca cagcagtgac ttctcctgga 961 ctgaactgaa gagactcaat gctggatcct ggttcctaga gaggcgaccc ttctgggggg 1021 ccaaaccgct ggcaggccct gatcagaaag aggctgagag tcagacggta ccagcattag 1081 aagagctatt ggaggaagct gcagccctca acctttccat catgttcgac ttgcgccgac 1141 ccccacagaa ccacacatac tatgacactt ttgtgatcca gacattggag actgtgctga 1201 atgcaagggt gccccaagcc atggtctttt GGCTACCAGA TGAAGATCGG GCTAATGTCC 1261 AACGACGGGC ACCTGGAATG CGCCAGATAT ATGGACGTCA GGGAGGCAAC AGAACGGAGA 1321 GGCCCCAGTT TCTTAACCTC CCCTATCAAG ATCTGCCACT ATTGGATATC AAGGCATTGC 1381 ATAAGGATAA TGTCTCGGTG AACCTATTTG TAGTGAACAA GCCCTGGCTC TTCTCTCTGC 1441 TTTGGTGTGC AGGGGTGGAT TCGGTCACCA CCAACGACTG CCAGCTGCTG CAGCAGATGC 1501 GTTACCCTAT CTGGCTTATT ACCCCTCAAA CCTACCTAAT CATATGGGTC ATTACCAATT 1561 GTGTTTCCAC CATGCTGCTT TTGTGGACCT TCCTCCTCCA AAGGAGATTT GTTAAGAAGA 1621 GAGGGAAAAC TGGCTTAGAA ACAGCAGTGC TGCTGACAAG GATCAACAAT TTCATGATGG 1681 AGTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1741 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1801 GGCTTTATAT ATCTTGTGGA AAGGACGACC TTAGTATTGT CCATTTGACT AAACGCGTTA 1861 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt