Transcript: Mouse NM_001305941.1

Mus musculus glycerophosphodiester phosphodiesterase domain containing 2 (Gdpd2), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Gdpd2 (71584)
Length:
2451
CDS:
196..1815

Additional Resources:

NCBI RefSeq record:
NM_001305941.1
NBCI Gene record:
Gdpd2 (71584)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000099374 CCACTGGAGGAAATATCCTAA pLKO.1 258 CDS 100% 4.950 3.465 N Gdpd2 n/a
2 TRCN0000099373 CCAGGATAATATCTCAGTGAA pLKO.1 1515 CDS 100% 4.950 3.465 N Gdpd2 n/a
3 TRCN0000099371 CCTTTCCATCATGTTTGACTT pLKO.1 1245 CDS 100% 4.950 3.465 N Gdpd2 n/a
4 TRCN0000099372 GCATCATGAAACTCAGAGATT pLKO.1 836 CDS 100% 4.950 3.465 N Gdpd2 n/a
5 TRCN0000099370 CCCTCACACTTCATCTTCTTT pLKO.1 2272 3UTR 100% 5.625 3.375 N Gdpd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305941.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08422 pDONR223 100% 86.1% 84.8% None (many diffs) n/a
2 ccsbBroad304_08422 pLX_304 0% 86.1% 84.8% V5 (many diffs) n/a
3 TRCN0000468558 CCTTAGTATTGTCCATTTGACTAA pLX_317 28.2% 86.1% 84.8% V5 (many diffs) n/a
Download CSV