Transcript: Human NM_001171192.1

Homo sapiens glycerophosphodiester phosphodiesterase domain containing 2 (GDPD2), transcript variant 1, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
GDPD2 (54857)
Length:
2443
CDS:
362..2134

Additional Resources:

NCBI RefSeq record:
NM_001171192.1
NBCI Gene record:
GDPD2 (54857)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430858 ATGTCTCGGTGAACCTATTTG pLKO_005 1839 CDS 100% 13.200 18.480 N GDPD2 n/a
2 TRCN0000048936 CCACACATACTATGACACTTT pLKO.1 1447 CDS 100% 4.950 6.930 N GDPD2 n/a
3 TRCN0000048933 CCACGAATGTAGCCTCTGTAT pLKO.1 1194 CDS 100% 4.950 6.930 N GDPD2 n/a
4 TRCN0000048934 CGTTACCCTATCTGGCTTATT pLKO.1 1949 CDS 100% 13.200 10.560 N GDPD2 n/a
5 TRCN0000174086 CGTTACCCTATCTGGCTTATT pLKO.1 1949 CDS 100% 13.200 10.560 N GDPD2 n/a
6 TRCN0000420171 CACCTGGAATGCGCCAGATAT pLKO_005 1566 CDS 100% 13.200 9.240 N GDPD2 n/a
7 TRCN0000048935 GCTGACAAGGATCAACAATTT pLKO.1 2101 CDS 100% 13.200 9.240 N GDPD2 n/a
8 TRCN0000435552 CACCCAAGCCAGTCTACATTG pLKO_005 2154 3UTR 100% 10.800 7.560 N GDPD2 n/a
9 TRCN0000048937 CCCTCAAACCTACCTAATCAT pLKO.1 1972 CDS 100% 5.625 3.938 N GDPD2 n/a
10 TRCN0000174087 CCCTCAAACCTACCTAATCAT pLKO.1 1972 CDS 100% 5.625 3.938 N GDPD2 n/a
11 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1740 CDS 100% 5.625 2.813 Y KLHL30 n/a
12 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1740 CDS 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171192.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08422 pDONR223 100% 91.2% 91.3% None 1308_1460del;1692A>G n/a
2 ccsbBroad304_08422 pLX_304 0% 91.2% 91.3% V5 1308_1460del;1692A>G n/a
3 TRCN0000468558 CCTTAGTATTGTCCATTTGACTAA pLX_317 28.2% 91.2% 91.3% V5 1308_1460del;1692A>G n/a
Download CSV