Construct: ORF TRCN0000468574
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004021.1_s317c1
- Derived from:
- ccsbBroadEn_09704
- DNA Barcode:
- ATCTGGCTAATGGAGCTGCTTCCC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SNRNP48 (154007)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468574
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 154007 | SNRNP48 | small nuclear ribonucleopro... | NM_152551.4 | 99.9% | 99.7% | 134C>T |
| 2 | human | 154007 | SNRNP48 | small nuclear ribonucleopro... | XM_011514312.3 | 93.8% | 93.8% | 89_90ins63 |
| 3 | human | 154007 | SNRNP48 | small nuclear ribonucleopro... | XR_427825.2 | 17.4% | (many diffs) | |
| 4 | mouse | 67797 | Snrnp48 | small nuclear ribonucleopro... | NM_026382.2 | 86.3% | 86.4% | (many diffs) |
| 5 | mouse | 67797 | Snrnp48 | small nuclear ribonucleopro... | XM_017315577.1 | 57.7% | 52.5% | (many diffs) |
| 6 | mouse | 67797 | Snrnp48 | small nuclear ribonucleopro... | XM_006516735.1 | 52.2% | 53.3% | (many diffs) |
| 7 | mouse | 67797 | Snrnp48 | small nuclear ribonucleopro... | XM_011244332.2 | 36.6% | 33.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1086
- ORF length:
- 1017
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggagggcgag cctccacctg tggaggagcg gcggcggctg caggaggagc 121 tgaacgagtt cgtggagagc ggctgccgga cgttggagga ggtgaccgcg tccctgggct 181 gggacctaga tagtctggat ctcggggaag aggaggcggc ggaggatgaa gttgtgatat 241 gtccatacga ttccaatcat cacatgccta aatcatcttt ggcaaagcac atggcatctt 301 gtagattgag gaaaatgggc tataccaaag aagaagagga tgaaatgtat aatcctgagt 361 ttttctatga aaatgtgaag ataccttcga ttactttgaa taaggactca caattccaga 421 taattaaaca agctagaact gcagttggga aagacagtga ttgttataat caaagaattt 481 attcttcatt gcctgttgaa gttcctttga atcacaaacg gtttgtttgt gatctaactc 541 aagctgatcg tcttgccctc tatgatttcg tagttgagga gacaaagaaa aagcgctctg 601 attctcaaat tattgaaaat gacagcgatc tctttgtaga cttggctgcc aaaatcaatc 661 aagacaatag tcgaaaaagt ccaaaaTCCT ACCTTGAAAT CCTGGCAGAA GTACGAGATT 721 ATAAAAGAAG ACGCCAGTCC TATAGAGCCA AGAATGTTCA CATAACCAAG AAATCATATA 781 CTGAGGTGAT TCGAGATGTG ATAAATGTGC ACATGGAAGA ACTCAGCAAT CATTGGCAAG 841 AAGAGCAAGA GAAGGCAGAG GATGATGCCG AAAAGAATGA AGAAAGGCGA TCAGCTTCAG 901 TAGATTCACG GCAGTCTGGT GGAAGCTATT TGGATGCTGA GTGTTCACGA CATAGAAGGG 961 ATAGGAGTAG AAGCCCACAT AAAAGAAAAA GAAACAAAGA TAAGGATAAA AACTGTGAGT 1021 CGAGAAGAAG GAAAGAGAGG GATGGGGAAA GACACCATAG TCATAAAAGA AGAAAGCAAA 1081 AAATATTGCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1141 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1201 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATCTGGCTA ATGGAGCTGC TTCCCACGCG 1261 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt