Transcript: Mouse NM_026382.2

Mus musculus small nuclear ribonucleoprotein 48 (U11/U12) (Snrnp48), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Snrnp48 (67797)
Length:
1789
CDS:
35..1048

Additional Resources:

NCBI RefSeq record:
NM_026382.2
NBCI Gene record:
Snrnp48 (67797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_026382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127304 GCGGTAGGTATGTTTAAGTTA pLKO.1 1577 3UTR 100% 5.625 7.875 N Snrnp48 n/a
2 TRCN0000127305 GCTGCTAAAGTCAATCAAGAT pLKO.1 611 CDS 100% 4.950 6.930 N Snrnp48 n/a
3 TRCN0000328484 CAGTACTTGAGATAGGTAAAT pLKO_005 1290 3UTR 100% 13.200 10.560 N Snrnp48 n/a
4 TRCN0000353519 GAGCTAAGAATGTTCACATAA pLKO_005 711 CDS 100% 13.200 9.240 N Snrnp48 n/a
5 TRCN0000328485 TCGCCTTGCCCTGTATGATTT pLKO_005 514 CDS 100% 13.200 9.240 N Snrnp48 n/a
6 TRCN0000328547 CCCAAATCATCACTAACAAAG pLKO_005 233 CDS 100% 10.800 7.560 N Snrnp48 n/a
7 TRCN0000328486 CCGAGGATGAAATCGCCATAT pLKO_005 186 CDS 100% 10.800 7.560 N Snrnp48 n/a
8 TRCN0000127307 CTGGGAAAGATGGTGATTGTT pLKO.1 411 CDS 100% 5.625 3.938 N Snrnp48 n/a
9 TRCN0000127306 GCATGCCCAAATCATCACTAA pLKO.1 228 CDS 100% 4.950 3.465 N Snrnp48 n/a
10 TRCN0000127308 GCCGAGGATGAAATCGCCATA pLKO.1 185 CDS 100% 4.050 2.835 N Snrnp48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_026382.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09704 pDONR223 100% 86.3% 86.4% None (many diffs) n/a
2 ccsbBroad304_09704 pLX_304 0% 86.3% 86.4% V5 (many diffs) n/a
3 TRCN0000468574 ATCTGGCTAATGGAGCTGCTTCCC pLX_317 39.4% 86.3% 86.4% V5 (many diffs) n/a
Download CSV