Transcript: Mouse XM_011244332.2

PREDICTED: Mus musculus small nuclear ribonucleoprotein 48 (U11/U12) (Snrnp48), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snrnp48 (67797)
Length:
560
CDS:
60..509

Additional Resources:

NCBI RefSeq record:
XM_011244332.2
NBCI Gene record:
Snrnp48 (67797)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_011244332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328547 CCCAAATCATCACTAACAAAG pLKO_005 258 CDS 100% 10.800 7.560 N Snrnp48 n/a
2 TRCN0000328486 CCGAGGATGAAATCGCCATAT pLKO_005 211 CDS 100% 10.800 7.560 N Snrnp48 n/a
3 TRCN0000127307 CTGGGAAAGATGGTGATTGTT pLKO.1 436 CDS 100% 5.625 3.938 N Snrnp48 n/a
4 TRCN0000127306 GCATGCCCAAATCATCACTAA pLKO.1 253 CDS 100% 4.950 3.465 N Snrnp48 n/a
5 TRCN0000127308 GCCGAGGATGAAATCGCCATA pLKO.1 210 CDS 100% 4.050 2.835 N Snrnp48 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011244332.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09704 pDONR223 100% 36.6% 33.6% None (many diffs) n/a
2 ccsbBroad304_09704 pLX_304 0% 36.6% 33.6% V5 (many diffs) n/a
3 TRCN0000468574 ATCTGGCTAATGGAGCTGCTTCCC pLX_317 39.4% 36.6% 33.6% V5 (many diffs) n/a
Download CSV