Construct: ORF TRCN0000468581
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003765.1_s317c1
- Derived from:
- ccsbBroadEn_07125
- DNA Barcode:
- CAGGCACAACCGTATGTTACAAGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- USF1 (7391)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468581
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7391 | USF1 | upstream transcription fact... | NM_001276373.2 | 99.8% | 99.6% | 71C>N |
| 2 | human | 7391 | USF1 | upstream transcription fact... | NM_007122.5 | 99.8% | 99.6% | 71C>N |
| 3 | human | 7391 | USF1 | upstream transcription fact... | NM_207005.3 | 80.9% | 80.9% | 0_1ins177 |
| 4 | mouse | 22278 | Usf1 | upstream transcription fact... | NM_001305676.1 | 90.3% | 98% | (many diffs) |
| 5 | mouse | 22278 | Usf1 | upstream transcription fact... | NM_001305677.1 | 90.3% | 98% | (many diffs) |
| 6 | mouse | 22278 | Usf1 | upstream transcription fact... | NM_009480.3 | 90.3% | 98% | (many diffs) |
| 7 | mouse | 22278 | Usf1 | upstream transcription fact... | NM_001305678.1 | 72.4% | 79.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 996
- ORF length:
- 930
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ggggcagcag aaaacagctg aaacggaaga ggggacagtg cagattcagg 121 aaggtgcagt ggctantggg gaagacccaa ccagtgtggc tattgccagc atccagtcag 181 ctgccacctt ccctgacccc aacgtcaagt acgtcttccg aactgagaat gggggccagg 241 tgatgtacag ggtgatccag gtgtctgagg ggcagctgga tggccaaact gagggaactg 301 gcgccatcag tggctaccct gccactcaat ccatgaccca ggcggtgatc cagggtgctt 361 tcaccagtga tgatgcagtt gacacggagg ggacagctgc tgagacgcac tatacttact 421 tccccagcac ggcagtggga gatggggcag ggggtaccac atcggggagt acagctgctg 481 ttgttactac ccagggctca gaggcactgc tggggcaggc gacccctcct ggcactggtc 541 aattctttgt gatgatgtca ccacaagaag tactgcaggg aggaagccag cgctcaattg 601 ccccTAGGAC TCACCCTTAT TCCCCGAAGT CAGAAGCTCC CCGGACGACT CGGGATGAGA 661 AACGCAGGGC TCAGCATAAT GAAGTGGAGC GTCGCCGCCG AGACAAGATC AACAACTGGA 721 TCGTGCAGCT CTCCAAGATA ATCCCAGACT GCTCTATGGA GAGCACCAAG TCTGGCCAGA 781 GTAAAGGTGG GATTCTATCC AAAGCTTGTG ATTATATCCA GGAGCTTCGG CAGAGTAACC 841 ACCGCTTGTC TGAAGAACTG CAGGGACTTG ACCAACTGCA GCTGGACAAT GACGTGCTTC 901 GACAACAGGT GGAAGATCTT AAAAACAAGA ATCTGCTGCT TCGAGCTCAG TTGCGGCACC 961 ACGGATTAGA GGTCGTCATC AAGAATGACA GCAACTACCC AACTTTCTTG TACAAAGTGG 1021 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 1081 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 1141 ACAGGCACAA CCGTATGTTA CAAGCACGCG TTAAGTCgac aatcaacctc tggattacaa 1201 aatttgtgaa agatt