Transcript: Human NM_207005.3

Homo sapiens upstream transcription factor 1 (USF1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
USF1 (7391)
Length:
1776
CDS:
352..1107

Additional Resources:

NCBI RefSeq record:
NM_207005.3
NBCI Gene record:
USF1 (7391)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020679 GCTGGATACTGGACACACTAA pLKO.1 1378 3UTR 100% 4.950 6.930 N USF1 n/a
2 TRCN0000020682 CCACGGATTAGAGGTCGTCAT pLKO.1 1068 CDS 100% 4.050 5.670 N USF1 n/a
3 TRCN0000233478 CAACAGGTGGAAGATCTTAAA pLKO_005 1012 CDS 100% 13.200 10.560 N USF1 n/a
4 TRCN0000233475 CAGCTGCTGAGACGCACTATA pLKO_005 503 CDS 100% 13.200 9.240 N USF1 n/a
5 TRCN0000233476 CCCTAGGACTCACCCTTATTC pLKO_005 711 CDS 100% 13.200 9.240 N USF1 n/a
6 TRCN0000020680 CGTGCAGCTCTCCAAGATAAT pLKO.1 831 CDS 100% 13.200 9.240 N USF1 n/a
7 TRCN0000233477 GAGTAAAGGTGGGATTCTATC pLKO_005 888 CDS 100% 10.800 7.560 N USF1 n/a
8 TRCN0000233479 TTCCCTGGAGCTGAGGTTTAG pLKO_005 1504 3UTR 100% 10.800 7.560 N USF1 n/a
9 TRCN0000020681 CACTGGTCAATTCTTTGTGAT pLKO.1 642 CDS 100% 4.950 3.465 N USF1 n/a
10 TRCN0000020683 CCAGTGATGATGCAGTTGACA pLKO.1 473 CDS 100% 3.000 2.100 N USF1 n/a
11 TRCN0000071894 CATCAAGAATGACAGCAACTA pLKO.1 1086 CDS 100% 4.950 2.970 N Usf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207005.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07125 pDONR223 100% 80.9% 80.9% None 0_1ins177 n/a
2 ccsbBroad304_07125 pLX_304 0% 80.9% 80.9% V5 0_1ins177 n/a
3 TRCN0000468581 CAGGCACAACCGTATGTTACAAGC pLX_317 42.3% 80.9% 80.9% V5 0_1ins177 n/a
Download CSV