Transcript: Mouse NM_001305677.1

Mus musculus upstream transcription factor 1 (Usf1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Usf1 (22278)
Length:
1863
CDS:
278..1210

Additional Resources:

NCBI RefSeq record:
NM_001305677.1
NBCI Gene record:
Usf1 (22278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001305677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311049 GAAACGGAGGGCTCAACATAA pLKO_005 871 CDS 100% 13.200 10.560 N Usf1 n/a
2 TRCN0000071893 GCTGAGACACATTATACATAT pLKO.1 611 CDS 100% 13.200 9.240 N Usf1 n/a
3 TRCN0000302005 GCTGAGACACATTATACATAT pLKO_005 611 CDS 100% 13.200 9.240 N Usf1 n/a
4 TRCN0000304623 GAGTACTACAGCTGTTGTTAC pLKO_005 679 CDS 100% 10.800 7.560 N Usf1 n/a
5 TRCN0000311052 GGACACTGGACACACTGAATC pLKO_005 1484 3UTR 100% 10.800 7.560 N Usf1 n/a
6 TRCN0000071897 CCAGAGTAAAGGTGGAATCCT pLKO.1 988 CDS 100% 3.000 2.100 N Usf1 n/a
7 TRCN0000071896 CCACAAGAAGTATTGCAGGGA pLKO.1 773 CDS 100% 0.660 0.462 N Usf1 n/a
8 TRCN0000304624 TCCAAAGCCTGTGATTATATC pLKO_005 1010 CDS 100% 13.200 7.920 N Usf1 n/a
9 TRCN0000071894 CATCAAGAATGACAGCAACTA pLKO.1 1189 CDS 100% 4.950 2.970 N Usf1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001305677.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07125 pDONR223 100% 90.3% 98% None (many diffs) n/a
2 ccsbBroad304_07125 pLX_304 0% 90.3% 98% V5 (many diffs) n/a
3 TRCN0000468581 CAGGCACAACCGTATGTTACAAGC pLX_317 42.3% 90.3% 98% V5 (many diffs) n/a
Download CSV