Construct: ORF TRCN0000468613
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007238.1_s317c1
- Derived from:
- ccsbBroadEn_03290
- DNA Barcode:
- TACCATACACATGTCAGTCCAGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TEX264 (51368)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468613
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001129884.2 | 100% | 100% | |
| 2 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243725.2 | 100% | 100% | |
| 3 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243726.2 | 100% | 100% | |
| 4 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001278195.1 | 100% | 100% | |
| 5 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_015926.6 | 100% | 100% | |
| 6 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713195.3 | 100% | 100% | |
| 7 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713197.4 | 100% | 100% | |
| 8 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_011533805.2 | 100% | 100% | |
| 9 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NM_001243727.2 | 76.3% | 76.3% | 257_258ins222 |
| 10 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_006713198.2 | 76.1% | 73.8% | (many diffs) |
| 11 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_103462.1 | 57.8% | (many diffs) | |
| 12 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_024012.3 | 56.6% | (many diffs) | |
| 13 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | NR_103463.1 | 56.2% | (many diffs) | |
| 14 | human | 51368 | TEX264 | testis expressed 264, ER-ph... | XM_017006574.2 | 55.4% | 52.7% | (many diffs) |
| 15 | human | 100996349 | LOC100996349 | testis expressed 264, ER-ph... | NR_103470.1 | 13.9% | (many diffs) | |
| 16 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_001081654.2 | 85% | 83% | (many diffs) |
| 17 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_001286498.1 | 85% | 83% | (many diffs) |
| 18 | mouse | 21767 | Tex264 | testis expressed gene 264 | NM_011573.3 | 85% | 83% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1005
- ORF length:
- 939
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggacctgcta ctactgggcc tgattggggg cctgactctc ttactgctgc 121 tgacgctgct ggcctttgcc gggtactcag ggctactggc tggggtggaa gtgagtgctg 181 ggtcaccccc catccgcaac gtcactgtgg cctacaagtt ccacatgggg ctctatggtg 241 agactgggcg gcttttcact gagagctgca gcatctctcc caagctccgc tccatcgctg 301 tctactatga caacccccac atggtgcccc ctgataagtg ccgatgtgcc gtgggcagca 361 tcctgagtga aggtgaggaa tcgccctccc ctgagctcat cgacctctac cagaaatttg 421 gcttcaaggt gttctccttc ccggcaccca gccatgtggt gacagccacc ttcccctaca 481 ccaccattct gtccatctgg ctggctaccc gccgtgtcca tcctgccttg gacacctaca 541 tcaaggagcg gaagctgtgt gcctatcctc ggctggagat ctaccaggaa gaccagatcc 601 atttcatgtg cccactggca cggcagggag acttctatgt gccTGAGATG AAGGAGACAG 661 AGTGGAAATG GCGGGGGCTT GTGGAGGCCA TTGACACCCA GGTGGATGGC ACAGGAGCTG 721 ACACAATGAG TGACACGAGT TCTGTAAGCT TGGAAGTGAG CCCTGGCAGC CGGGAGACTT 781 CAGCTGCCAC ACTGTCACCT GGGGCGAGCA GCCGTGGCTG GGATGACGGT GACACCCGCA 841 GCGAGCACAG CTACAGCGAG TCAGGTGCCA GCGGCTCCTC TTTTGAGGAG CTGGACTTGG 901 AGGGCGAGGG GCCCTTAGGG GAGTCACGGC TGGACCCTGG GACTGAGCCC CTGGGGACTA 961 CCAAGTGGCT CTGGGAGCCC ACTGCCCCTG AGAAGGGCAA GGAGTACCCA ACTTTCTTGT 1021 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 1081 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTC TTGGCTTTAT ATATCTTGTG 1141 GAAAGGACGA TACCATACAC ATGTCAGTCC AGTCACGCGT TAAGTCgaca atcaacctct 1201 ggattacaaa atttgtgaaa gatt