Transcript: Human NM_015926.6

Homo sapiens testis expressed 264, ER-phagy receptor (TEX264), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
TEX264 (51368)
Length:
1320
CDS:
72..1013

Additional Resources:

NCBI RefSeq record:
NM_015926.6
NBCI Gene record:
TEX264 (51368)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015926.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373746 ACGTCACTGTGGCCTACAAGT pLKO_005 205 CDS 100% 4.950 3.960 N TEX264 n/a
2 TRCN0000162473 CTACCAGAAATTTGGCTTCAA pLKO.1 413 CDS 100% 4.950 3.960 N TEX264 n/a
3 TRCN0000164611 CATCGACCTCTACCAGAAATT pLKO.1 404 CDS 100% 13.200 9.240 N TEX264 n/a
4 TRCN0000166250 CCAGGAAGACCAGATCCATTT pLKO.1 590 CDS 100% 10.800 7.560 N TEX264 n/a
5 TRCN0000373744 GAAGGAGACAGAGTGGAAATG pLKO_005 656 CDS 100% 10.800 7.560 N TEX264 n/a
6 TRCN0000373745 TCCATCGCTGTCTACTATGAC pLKO_005 297 CDS 100% 4.950 3.465 N TEX264 n/a
7 TRCN0000164708 CCATCGCTGTCTACTATGACA pLKO.1 298 CDS 100% 3.000 2.100 N TEX264 n/a
8 TRCN0000165601 GTGACACGAGTTCTGTAAGCT pLKO.1 736 CDS 100% 3.000 2.100 N TEX264 n/a
9 TRCN0000164799 GAGACTTCTATGTGCCTGAGA pLKO.1 634 CDS 100% 2.640 1.848 N TEX264 n/a
10 TRCN0000166182 CAGATCCATTTCATGTGCCCA pLKO.1 600 CDS 100% 0.660 0.462 N TEX264 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015926.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03290 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03290 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468613 TACCATACACATGTCAGTCCAGTC pLX_317 38.7% 100% 100% V5 n/a
4 TRCN0000489264 CATACTGTGCAGTTTTTCGAACGA pLX_317 38.8% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV