Construct: ORF TRCN0000468625
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009143.1_s317c1
- Derived from:
- ccsbBroadEn_11661
- DNA Barcode:
- GATCTTGCCCCCGGTACACGGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KDM4B (23030)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468625
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23030 | KDM4B | lysine demethylase 4B | NM_001370093.1 | 99.8% | 100% | 348T>C;1080A>G |
| 2 | human | 23030 | KDM4B | lysine demethylase 4B | XM_017026504.2 | 85% | 80.2% | (many diffs) |
| 3 | human | 23030 | KDM4B | lysine demethylase 4B | NM_001370094.1 | 80.4% | 81.4% | (many diffs) |
| 4 | human | 23030 | KDM4B | lysine demethylase 4B | XM_011527819.2 | 71.1% | 69% | (many diffs) |
| 5 | human | 23030 | KDM4B | lysine demethylase 4B | XM_011527820.2 | 71.1% | 69% | (many diffs) |
| 6 | human | 23030 | KDM4B | lysine demethylase 4B | XM_011527821.2 | 71.1% | 69% | (many diffs) |
| 7 | human | 23030 | KDM4B | lysine demethylase 4B | XM_017026505.2 | 71.1% | 69% | (many diffs) |
| 8 | human | 23030 | KDM4B | lysine demethylase 4B | XR_936167.2 | 70.3% | (many diffs) | |
| 9 | human | 23030 | KDM4B | lysine demethylase 4B | XM_011527822.2 | 69.2% | 68.3% | (many diffs) |
| 10 | human | 23030 | KDM4B | lysine demethylase 4B | NM_015015.3 | 39% | 35.5% | (many diffs) |
| 11 | human | 23030 | KDM4B | lysine demethylase 4B | XM_005259521.4 | 36.8% | 34.9% | (many diffs) |
| 12 | human | 23030 | KDM4B | lysine demethylase 4B | XM_017026503.1 | 36.8% | 34.9% | (many diffs) |
| 13 | human | 23030 | KDM4B | lysine demethylase 4B | XM_011527814.2 | 28.8% | 26.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1410
- ORF length:
- 1344
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gtctgaggac cacggcgccc agaaccccag ctgtaaaatc atgacgtttc 121 gcccaaccat ggaagaattt aaagacttca acaaatacgt ggcctacata gagtcgcagg 181 gagcccaccg ggcgggcctg gccaagatca tccccccgaa ggagtggaag ccgcggcaga 241 cgtatgatga catcgacgac gtggtgatcc cggcgcccat ccagcaggtg gtgacgggcc 301 agtcgggcct cttcacgcag tacaatatcc agaagaaggc catgacagtg ggcgagtacc 361 gccgcctggc caacagcgag aagtactgta ccccgcggca ccaggacttt gacgaccttg 421 aacgcaaata ctggaagaac ctcacctttg tctccccgat ctacggggct gacatcagcg 481 gctctttgta tgatgacgac gtggcccagt ggaacatcgg gagcctccgg accatcctgg 541 acatggtgga gcgcgagtgc ggcaccatca tcgagggcgt gaacacgccc tacctgtact 601 tcggcatgtg gaagaccacc ttcgcctggc acaccgagga catggacctg tacagcatca 661 actacctgca ctttggggag cctaagtcct ggtacgccat cccaccagag cacggcaagc 721 gcctggagcg gctggccatc ggcttcttcc ccgggagctc gcagggctgc gacgccttcc 781 tgcggcataa gatgaccctc atctcgccca tcatcctgaa gaagtacggg atccccttca 841 gccggatcac gcaggaggcc ggggaattca tgatcacatt tccctacggc taccacgccg 901 gcttcaatca cgggttcaac tgcgcagaat ctaccaactt cgccaccctg cggtggattg 961 actacggcaa agtggccact cagtgcacgt gccggaagga catggtcaag atctccatgg 1021 acgtgttcgt gcgcaTCCTG CAGCCCGAGC GCTACGAGCT GTGGAAGCAG GGCAAGGACC 1081 TCACGGTGCT GGACCACACG CGGCCCACGG CGCTCACCAG CCCCGAGCTG AGCTCCTGGA 1141 GTGCGTCCCG GGCCTCGCTG AAGGCCAAGC TCCTCCGCAG AACCCCTCCC TGCGTATCGC 1201 CGCACAGACC CTCCCAGCCA GGTATCTGGT GTCCGCCTGG AGGAGAGGCC AAAGCATCTG 1261 CAGCCTCTTG GCTTCTGACC ACAAGAGGCC ATGGGGACAC GGAGGCAGGT CCCGGCCTAG 1321 GAGGAGATCC ACTTCATGCC CAGAGTGAAG GCCAGGCCTC CTGTGTCTCG ACGTCTCGAC 1381 TCCGCATGGC AACTCAAGAC CCTTGCAGAT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1441 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1501 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAGATCT 1561 TGCCCCCGGT ACACGGACAA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1621 tgaaagatt