Transcript: Human XR_936167.2

PREDICTED: Homo sapiens lysine demethylase 4B (KDM4B), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KDM4B (23030)
Length:
1475
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_936167.2
NBCI Gene record:
KDM4B (23030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_936167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000018017 GCGGCAGACGTATGATGACAT pLKO.1 420 3UTR 100% 4.950 6.930 N KDM4B n/a
2 TRCN0000018015 GCGGCATAAGATGACCCTCAT pLKO.1 919 3UTR 100% 4.050 5.670 N KDM4B n/a
3 TRCN0000329964 GATGACCTTGAACGCAAATAC pLKO_005 598 3UTR 100% 13.200 9.240 N KDM4B n/a
4 TRCN0000380859 GCCTCTTCACGCAGTACAATA pLKO_005 494 3UTR 100% 13.200 9.240 N KDM4B n/a
5 TRCN0000018014 GCCCATCATCCTGAAGAAGTA pLKO.1 943 3UTR 100% 4.950 3.465 N KDM4B n/a
6 TRCN0000329961 GCCCATCATCCTGAAGAAGTA pLKO_005 943 3UTR 100% 4.950 3.465 N KDM4B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_936167.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11661 pDONR223 100% 70.3% None (many diffs) n/a
2 ccsbBroad304_11661 pLX_304 0% 70.3% V5 (many diffs) n/a
3 TRCN0000468625 GATCTTGCCCCCGGTACACGGACA pLX_317 28.2% 70.3% V5 (many diffs) n/a
Download CSV