Construct: ORF TRCN0000468677
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018850.3_s317c1
- Derived from:
- ccsbBroadEn_14742
- DNA Barcode:
- AGGTCTCTTACCTTAGGAGACTTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKFB1 (5207)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468677
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271805.1 | 81.6% | 71.1% | (many diffs) |
| 2 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_024452389.1 | 80.4% | 65.1% | (many diffs) |
| 3 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_001271804.2 | 80.3% | 69.3% | (many diffs) |
| 4 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029578.1 | 79.6% | 64.9% | (many diffs) |
| 5 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NM_002625.4 | 74.5% | 62.2% | (many diffs) |
| 6 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029576.1 | 71.7% | 58.9% | (many diffs) |
| 7 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | XM_017029577.1 | 63.8% | 48.8% | (many diffs) |
| 8 | human | 5207 | PFKFB1 | 6-phosphofructo-2-kinase/fr... | NR_073450.2 | 56.7% | (many diffs) | |
| 9 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | NM_008824.3 | 75.1% | 67.2% | (many diffs) |
| 10 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_011247791.2 | 75.1% | 67.2% | (many diffs) |
| 11 | mouse | 18639 | Pfkfb1 | 6-phosphofructo-2-kinase/fr... | XM_006528755.2 | 71% | 60.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1290
- ORF length:
- 1221
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaagctctgc gtgactgtcc tgtctctcct catgctagta gctgccttct 121 gctctccagc gctctcagca ccaagtaagt ctacttttgc agctgctatt tcgagtcaag 181 gtgtaggcag agtccttttt tctagtcatg gctggcaaac agtgggatct ggggatggga 241 caaaaggcag cttgccaact ttcttgtaca aagttggcat tatcagaaag cattgcttat 301 cacttcgctg caacgaacag gtcaccatca gtcaaaataa aatcattatt gccatccagc 361 tgattcccga cataattgca gaaaacatca ggcaagtgaa acttggcagc cctgattata 421 tagactgtga ccgggaaaag gttctggaag actttctaaa gagaattgag tgctatgagg 481 tcaactacca acccttggat gaggaactgg acagccacct gtcctacatc aagatcttcg 541 acgtgggcac acgctacatg gtgaaccgag tgcaggatca catccagagc cgcacagtct 601 actacctcat gaatatccat gtcacacctc gctccatcta cctttgccga catggcgaga 661 gtgaactcaa catcagaggc cgcatcggag gtgactctgg cctctcagtt cgcggcaagc 721 agtatgccta tgccctggcc aacttcattc agtcccaggg catcagctcc ctgaaggtgt 781 ggaccagtca catgaagagg accatccaga cagctgaggc cctgggtgtc ccctatgagc 841 agtggaaggc cctgaatgag attgatgcgg gtgtctgtga ggagatgacc tatgaagaaa 901 tccaggaaca ttaccctgaa gaatttgcac tgcgagacca agataaatat cgctaccgct 961 atccCAAGGG AGAGTCCTAT GAGGATCTGG TTCAGCGTCT GGAGCCAGTG ATAATGGAGC 1021 TAGAACGACA GGAGAATGTA CTGGTGATCT GCCACCAGGC TGTCATGCGG TGCCTCCTGG 1081 CCTATTTCCT GGATAAAAGT TCAGATGAGC TTCCATATCT CAAGTGCCCT CTGCACACAG 1141 TGCTCAAACT CACTCCTGTG GCTTATGGCT GCAAAGTGGA ATCCATCTAC CTGAATGTGG 1201 AGGCCGTGAA CACACACCGG GAGAAGCCTG AGAATGTGGA CATCACCCGG GAACCTGAGG 1261 AAGCCCTGGA TACTGTCCCA GCCCACTACT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1321 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1381 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAGGTC 1441 TCTTACCTTA GGAGACTTTA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1501 tgaaagatt