Construct: ORF TRCN0000468679
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006338.1_s317c1
- Derived from:
- ccsbBroadEn_04011
- DNA Barcode:
- GCAGACTTCAATCGCAACCAGCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BOLL (66037)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468679
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 66037 | BOLL | boule homolog, RNA binding ... | NM_033030.6 | 100% | 100% | |
| 2 | human | 66037 | BOLL | boule homolog, RNA binding ... | NM_001284362.2 | 97.9% | 97.9% | 1_18del |
| 3 | human | 66037 | BOLL | boule homolog, RNA binding ... | NM_197970.3 | 95.9% | 95.9% | 1_36del |
| 4 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_011511694.2 | 92.7% | 92.7% | 551_616del |
| 5 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_024453054.1 | 91.3% | 85.5% | 729_760del;837_838ins44 |
| 6 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_024453053.1 | 89.8% | 89.8% | 1_30del;581_646del |
| 7 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_011511692.3 | 89.2% | 89.2% | 1_36del;587_652del |
| 8 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_006712715.4 | 87.7% | 82.1% | 1_36del;765_796del;873_874ins44 |
| 9 | human | 66037 | BOLL | boule homolog, RNA binding ... | NM_001284361.2 | 82.7% | 81.7% | (many diffs) |
| 10 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_011511693.3 | 81.8% | 76.5% | (many diffs) |
| 11 | human | 66037 | BOLL | boule homolog, RNA binding ... | XM_017004773.2 | 68.1% | 64.7% | (many diffs) |
| 12 | human | 66037 | BOLL | boule homolog, RNA binding ... | NM_001284358.1 | 61.4% | 58.4% | 0_1ins196;25_26ins131 |
| 13 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | XM_011238613.1 | 88.1% | 89.4% | (many diffs) |
| 14 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | NM_029267.3 | 87% | 87.7% | (many diffs) |
| 15 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | XM_006496310.3 | 76% | 75.6% | (many diffs) |
| 16 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | NM_001113367.1 | 50.5% | 50.5% | (many diffs) |
| 17 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | XM_006496311.3 | 44.1% | 43.1% | (many diffs) |
| 18 | mouse | 75388 | Boll | bol, boule-like (Drosophila) | XR_373267.3 | 39.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 915
- ORF length:
- 849
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca aacagattca ttatctccat cccctaatcc tgtgtcacct gtgcctttga 121 ataacccaac aagtgcccca agatatggaa cagtgatccc taatcgcatc tttgtaggag 181 gaattgattt taagacaaac gaaagtgatt taagaaaatt tttttcccag tatgggtctg 241 tgaaagaagt gaagattgta aatgacagag ctggagtatc caaagggtat ggtttcgtca 301 cttttgaaac acaagaagat gcacaaaaaa ttttacaaga ggctgaaaaa cttaattata 361 aggataagaa gctgaacatt ggtccagcaa taagaaaaca acaagtaggg atccctcgtt 421 ctagtataat gccagcagct ggaacaatgt atctaacaac ttcaactgga tatccttata 481 cttaccataa tggtgttgct tattttcata ctccagaggt aacttcggtc ccaccgcctt 541 ggCCTTCACG TTCTGTATGT AGCTCCCCTG TGATGGTAGC TCAGCCCATT TATCAGCAAC 601 CTGCATATCA CTACCAGGCC ACCACACAGT ATTTACCAGG ACAGTGGCAG TGGAGTGTTC 661 CTCAGCCTTC TGCCTCTTCT GCTCCATTCT TATACCTGCA ACCTTCTGAG GTTATTTATC 721 AACCAGTGGA AATTGCACAG GATGGTGGAT GTGTTCCTCC TCCACTGTCT CTGATGGAAA 781 CTTCAGTTCC AGAGCCTTAT TCTGATCATG GAGTTCAAGC AACATATCAC CAGGTTTATG 841 CTCCAAGTGC CATCACTATG CCTGCGCCTG TGATGCAGCC TGAGCCAATT AAAACAGTGT 901 GGAGCATTCA TTATTACCCA ACTTTCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 961 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1021 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA GCAGACTTCA ATCGCAACCA 1081 GCGCACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt