Transcript: Mouse XM_006496311.3

PREDICTED: Mus musculus bol, boule-like (Drosophila) (Boll), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Boll (75388)
Length:
778
CDS:
60..683

Additional Resources:

NCBI RefSeq record:
XM_006496311.3
NBCI Gene record:
Boll (75388)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006496311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417899 TGATGCAGCCTGAGCCAATTA pLKO_005 502 CDS 100% 13.200 10.560 N BOLL n/a
2 TRCN0000102414 TCAACATTGGTCCAGCAATAA pLKO.1 17 5UTR 100% 13.200 9.240 N Boll n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006496311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04011 pDONR223 100% 44.1% 43.1% None (many diffs) n/a
2 ccsbBroad304_04011 pLX_304 0% 44.1% 43.1% V5 (many diffs) n/a
3 TRCN0000468679 GCAGACTTCAATCGCAACCAGCGC pLX_317 44% 44.1% 43.1% V5 (many diffs) n/a
Download CSV