Transcript: Human XM_011511692.3

PREDICTED: Homo sapiens boule homolog, RNA binding protein (BOLL), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BOLL (66037)
Length:
1574
CDS:
310..1263

Additional Resources:

NCBI RefSeq record:
XM_011511692.3
NBCI Gene record:
BOLL (66037)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011511692.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148756 CCCGTTGTGAAACTTAGTGTT pLKO.1 1358 3UTR 100% 4.950 6.930 N BOLL n/a
2 TRCN0000180858 GCTGGAGTATCCAAAGGGTAT pLKO.1 550 CDS 100% 4.050 5.670 N BOLL n/a
3 TRCN0000150225 GCAACATATCACCAGGTTTAT pLKO.1 1165 CDS 100% 13.200 9.240 N BOLL n/a
4 TRCN0000417899 TGATGCAGCCTGAGCCAATTA pLKO_005 1217 CDS 100% 13.200 9.240 N BOLL n/a
5 TRCN0000414919 ACTTCAACTGGATATCCTTAT pLKO_005 739 CDS 100% 10.800 7.560 N BOLL n/a
6 TRCN0000148757 CTGTGCCTTTGAATAACCCAA pLKO.1 389 CDS 100% 2.640 1.848 N BOLL n/a
7 TRCN0000102410 CGCATCTTTGTAGGAGGAATT pLKO.1 445 CDS 100% 0.000 0.000 N Boll n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011511692.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04011 pDONR223 100% 89.2% 89.2% None 1_36del;587_652del n/a
2 ccsbBroad304_04011 pLX_304 0% 89.2% 89.2% V5 1_36del;587_652del n/a
3 TRCN0000468679 GCAGACTTCAATCGCAACCAGCGC pLX_317 44% 89.2% 89.2% V5 1_36del;587_652del n/a
Download CSV